70
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 1
Use of Indigofera zollingeriana as a Forage Protein Source
in Dairy Goat Rations
Abdullah, L.
*
, D. Apriastuti & T.A.P. Apdini,
Department of Nutrition Science and Feed Technology, Bogor Agricultural University,
16680 Darmaga Bogor, Indonesia
*
Email of corresponding author: [email protected]
Introduction
Indigofera zollingeriana is a valuable shrubby legume that has been utilised by farmers to
improve dairy goat productivity in some areas in Indonesia. Use of Indigofera in Indonesia
has not been wide spread but some dairy goat farmers use this forage plant as protein source
instead of commercial concentrate because of the high cost of the latter. The quality of feed at
farm level often varies due to changes in the composition of some feed materials and this in
turn leads to unstable milk production and quality, particularly towards the end of the
lactation period.
The availability of the Indigofera herbage at the farm seems to be dependent on the
plant production system. It has been recommended that a tea plantation model be used to
enable an ideal and proportional harvest of young and old leaves so that the quality of
herbage remains high (Abdullah and Suharlina, 2010). The use of wilted Indigofera forage
including leaves and edible twigs has been shown to improve the average daily gain of local
goats up to 52.38 g/day in North Sumatera (Tarigan, 2009). This is understandable because
Indigofera is highly nutritional (Hassen et al., 2008), having a protein content of 27 to 31%,
digestible protein 75 to 87%, utilisable fibre (NDF 49–57%; ADF 32–38%), high dry matter
dig
estibility (72–81%), and low total tannin content (0.09–0.65%) (Abdullah, 2010).
It
has been reported that farmers face the problems of high feed cost and rapid
reduction of milk production two months prior to the end of lactation period if commercial
feed is used. Based on the above information, an experiment using pelleted pure Indigofera
feed (PIF) was conducted at Bangun Karso Farm. The objectives of the experiment were to
determine the effect of PIF on milk production prior to end of lactation, the feed cost and
efficiency of protein use.
Materials and methods
The experiment was conducted at Bangun Karso Farm which has been producing goat milk
for more than 5 years. The farm is located in the Cijeruk district about 18 km from Bogor.
Eight does comprising 4 lactating Saanen and 4 lactating Etawah crossbred (EC) goats were
used in the study. Each breed group was divided into two groups of 2 animals each and fed
two different rations, namely ration F1consisting of 60% elephant grass + 40% commercial
concentrate or ration F2 consisting of 60% elephant grass + 40% PIF (Apdini, 2011). The
Saanen and EC does were in the third and second lactation, respectively. Each ration was
given 4 times daily with a minimum amount of 4% live weight for 1 month prior to the end of
71
the lactation period. The nutritional composition of the rations was determined according to
Apdini (2011). Ration F1 contained 48.25% DM, 8.31% ash, 12.76% crude protein, 32.01%
crude fibre, 33.94% NFE and 57.98% TDN while ration F2 contained 48.85% DM, 7.82%
ash, 17.23% crude protein, 28.56% crude fibre, 34.81% NFE and 65.77% TDN. The
measured parameters are shown in Table 1. Data were analysed using statistical group
comparisons (Cooper and Schindler, 2003) and descriptive analysis.
Results and Discussion
The use of the PIF in ration resulted in a higher DM digestibility of the feed (17 to 73%), feed
efficiency (8 to 17%), protein use efficiency (1 to 2.5%), average milk production (121 to 383
mL/day), lower feed costs (USD 0.10 to 0.39) and feed conversion values than the
commercial concentrate. Daily milk production of the does fed the commercial feed tended to
decrease drastically (Figure 1) as indicated by the k-value as shown in Table 1. Drastic
reduction of milk production occurred in the Saanen goats that consumed commercial feed.
However, when PIF was given in the ration, the daily milk production of both groups of goats
stabilised towards the end of the lactation period. Based on feed DM digestibility, feed and
protein use efficiency, the Saanen goats seemed to be more responsive to PIF in the ration
than the EC does.
Figure
1. Change of goat milk production of end-lactation Period
F1 -60% elephant grass + 40% commercial feed; F2 - 60% elephant grass
+ 40% pure Indigofera feed (PIF). Data extracted from Apdini (2011).
Table 1. Use of pure Indigofera in dairy goat rations compared with the commercial
Feed
Saanen Etawah Crossbred
CF PIF CF PIF
Feed DM digestibility (%)* 40.59 70.13 45.47 63.08
Feed efficiency (%)
1
* 17.25 34.75 24.55 32.5
Feed conversion (kg feed/L milk) 5.8 2.9 4.1 3.1
Protein use efficiency (%)
2
* 4.50 7.00 5.35 6.20
Milk production (mL/day)
3
* 379 762 539 660
Feed cost (USD/L milk)
4
0.93 0.54 0.67 0.57
k-value of milk production
5
-8.57 -2.85 -0.32 3.54
72
*Source: data were calculated from Apdini (2011), CF = F1: 60% elephant grass + 40% commercial
feed, PIF = F2: 60% elephant grass + 40% pure Indigofera feed (PIF);
1
Portion of feed DM utilised to
produce 1L of milk,
2
proportion of feed protein utilised for milk protein,
3
Average milk production
(1month prior end-lactation period),
4
cost of feed required for producing 1L milk (CF USD 0.28/kg
and PIF USD 0.33).
5
determination value (-) = reduction, (+) = increment.
Economically, the use of 40% PIF in the ration could reduce feed conversion ratio and
costs by about 42% for the Saanen and 15% for the EC goats. Since feed contributes
approximately 70% towards the cost of production, substituting PIF for commercial feed
would reduce feed costs and provide more profits to the farmer. Thus this study showed that
the use of Indigofera herbage is very effective in stabilising milk production before
termination of the lactation period while improving the quality and reducing the cost of feed.
References
Abdullah, L., 2010. Herbage production and quality of shrub Indigofera treated by different
concentration of foliar fertiliser. Med. Pet.
33 (3): 169–175.
Abdullah,
L. and Suharlina, 2010. Herbage yield and quality of two vegetative parts of
Indigofera at different times of first regrowth defoliation. Med. Pet. 33
(1): 44–49.
Apdini, T.A.P., 2011
. Pemanfaatan pellet Indigofera pada kambing Peranakan Etawah dan
Saanen di peternakan Bangun Karso. Bachelero Thesis, Bogor Agricultural University.
Hassen, A., N.F.G. Rethman, W.A.Z. Apostolides and W.A. Van Niekerk, 2008. Forage
production and potential nutritive value of 24 shrubby Indigofera accessions under field
conditions in South Africa. Trop. Grasslands
42: 96–103.
Tarigan, A., 2009. Productivity and utilisation of Indigofera sp. as goat‟s feed obtained from
different interval and intensity of cutting. Thesis. Bogor Agricultural University, Indonesia.
Cooper, D.R. and P.S. Schindler, 2003. Business Research Methods. 8th Ed. McGraw Hill.
New York.
73
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 2
Protein Requirement for the Maintenance and Gain of Growing Goats Fed
Leucaena leucocephalade Roughage-Based Diets in Thailand
Chaokaur, A.
1*
, S. Poathong
2
, S. Srisuk
1
, S. Maiklang
1
, S. Wiangsanthiah
1
& C. Santhong
1
1
Faculty of Animal Science and Agriculture, Silpakorn University,
2
Pectchaburi Animal Research and Development Centre, 76120 Thailand
*
Email of corresponding author: [email protected]
Introduction
For many areas, goats are a major source of income for farmers, and there have been many
reports of crossbreeding programmes aimed at improving the productivity of native goats. It
has been reported that farmers could utilise the different Saanen crossbreds to improve pre-
weaning growth rate of goats in Southern Thailand (Supakorn and Pralomkarn, 2009).
Pralomkarn et al. (1995) reported that Thai native and Anglo-Nubain × Thai native goats
have similar protein and energy requirements for growth. This experiment was designed to
quantify the protein requirements for maintenance and growth of growing Anglo-Nubain
crossbred goats fed under tropical conditions in Thailand.
Materials and methods
Sixteen male Anglo-Nubain crossbred goats (weighing 19.03 ± 0.3 kg, aged 6 to 12 mo) were
housed in individual pens and fed Leucaena leucocephalade roughage-based diets with water
and minerals provided
ad libitum. They were assigned in a completely randomised design and
fed one of the four feeding treatments consisting of cassava chip supplementation at the rate 0,
0.5, 1.0
and 1.5% of body weight for a 91-day period. The weight of feed offered and refused
was recorded and feed sampled daily. Feed samples were analysed using standard methods
and animals were weighed weekly. The crude protein intake (CPI) and average daily gain
(ADG) data were regressed against time using linear regression (regression equation; CPI = a
+ b
ADG).
Results and Discussion
The results indicated that increased levels of cassava chips resulted in linear (P<0.05)
increases in roughage and protein intakes. However, the ADG was not different between
groups (Table 1). The protein requirement determined from the regression of ADG on CPI
exhibited a significant linear relationship [CPI = 1.1474 ADG + 157.35, (R
2
= 0.45; P<0.001;
RSD = 5.54; n = 12)] (Figure 1). The crude protein requirement for maintenance and gain
(100 g ADG) were 157 and 272 g/d, respectively.
74
Figure 1. The relationship between crude protein intake and average daily gain.
Table 1. Body weight and intake of growing goats given levels of cassava chip
supple
mentation.
Item Levels of cassava chip (%BW) P-value
1
0 0.5 1.0 1.5 L Q C
Number animal, head n = 4 n = 4 n = 3 n = 4
Initial weight, kg 19.34 19.09 18.57 19.10 - - -
Final weight, kg 27.95 27.30 26.49 28.75 ns ns ns
Average body weight, kg 23.65 23.20 22.53 23.93 ns ns ns
Average daily gain, g/d 94.56 90.28 87.01 106.04 ns ns ns
Roughage intake, kg DM/d 1.12 1.02 0.94 0.93 ** ns ns
Concentrate intake, kg
DM/d
0 0.10 0.19 0.29 ** ns ns
Total feed intake, kg DM/d 1.12 1.12 1.13 1.22 ns ns ns
Crude protein intake, kg
CP/d
0.29 0.27 0.25 0.25 ** ns ns
1
: Probability of a significant (P<0.05) effect of levels or of a linear (L) or quadratic (Q) or cubic (C) effect of feeding
levels.
Conclusions
The results indicated that the protein requirement for maintenance and growth for growing
Anglo-Nubain crossbred goats fed a Leucaena roughage-based diet with varying levels of
cassava chips under tropical condition were 157 and 272 g crude protein/d, respectively.
Ac
knowledgements
The authors would like to thank the Faculty of Animal Sciences and Agricultural Technology
Silpakorn University, Pectchaburi Animal Research and Development Centre, Thailand for
the funding.
References
Pralomkarn, W., S. Kochapakdee, S. Saithanoo and B.W. Norton, 1995. Energy and protein
utilisation for maintenance and growth of Thai native and Anglo-Nubian × Thai native male
wea
ner goats. Small Ruminant Res.
16: 13–20.
Supakorn, C. and W. Pralomkarn, 2009. Pre-weaning growth of goats for meat raised on a
commercial farm in Southern Thailand. Thai. J. Agri. Sci.
42 (1): 13–19.
75
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 3
Yield and Quality of Forage affected by Molybdenum Fertiliser and
Legume Genotypes
Susilawati, I.
1*
,
H. Djuned
1
, A.R. Tarmidi
2
& D. H. Arief
3
1
Laboratory of Forage Crops, Faculty of Animal Husbandry, Universitas Padjadjaran,
Jatinangor, Indonesia,
2
Laboratory of Feed Chemistry and Ruminant, Faculty of Animal
Husbandry, Universitas Padjadjaran, Jatinangor, Indonesia,
3
Laboratory of Soil
Microbiology, Faculty of Agriculture, Universitas Padjadjaran, Jatinangor, Indonesia.
*
Email of corresponding author: [email protected]
Introduction
Agricultural land in the tropics and subtropics are generally low in nitrogen which is required
in relatively high quantity and has a very significant effect on the productivity of plants,
including forage crops. Poor quality forage, including forage of low nitrogen content limits
livestock productivity. A large amount of nitrogen is present in the atmosphere (79% by
volume), but the majority of the plants cannot utilise it directly from the atmosphere. In
principle, increasing the nitrogen supply in the soil for plants could be done by increasing
biological nitrogen fixation or by the addition of inorganic nitrogen fertilizers. The
continuous use of artificial nitrogen fertilizers can lead to negative impact on the
environment. Therefore, in order to support the concept of sustainable agriculture, efforts to
increase the supply of nitrogen through biological nitrogen fixation by Rhizobium symbiosis
with legumes is appropriate. This study was carried out to examine the influence of
molybdenum fertilization and legume species on yield and quality of forage in mixed
cropping with Guinea grass (Panicum maximum) in the field.
Materials and methods
The investigation was carried out at the Faculty of Agriculture, Universitas Padjadjaran,
Jatinangor, Indonesia. A randomised block design with a factorial pattern group with 2
factors and 3 replications was used. The first factor consisted of three legume species; namely
Kudzu (Pueraria phaseoloides), Calopo (Calopogonium mucunoides), and mixed Kudzu with
Calopo, while the second factor was the molybdenum fertiliser given at 4 levels; namely 0, 3,
6 and 9 g/kg seed.
Results and Discussion
The results showed that the legume species significantly (P<0.05) affected the yield and
quality of forage crops, while molybdenum fertilizer did not significantly affect the yield and
crude protein content of the forage crops (Table 1). Kudzu showed higher dry matter yield
(11.19 t/ha) than other treatments. The molybdenum fertiliser at the rate of 6 g/kg seed
produced the highest crude protein content (10.73%) (Table 2).
76
Table 1. Mean dry matter yield of three legume genotypes treated with molybdenum fertilizer
Treatment
Dry matter yield (tonnes/ha)
Cutting sequence
First Second Third Total
Legume
Kudzu 2.86
a
4.20
a
4.13
a
11.19
Calopo 2.63
ab
4.19
a
3.96
ab
10.78
Kudzu + Calopo 2.38
b
3.49
b
3.41
b
9.28
Molybdenum
Without Mo 2.58 3.84 3.60 10.02
3 g kg
-1
seed 2.62 3.85 3.98 10.45
6 g kg
-1
seed 2.66 4.05 4.02 10.73
9 g kg
-1
seed 2.38 4.09 3.73 10.20
ab
Means within column with different superscripts differ at P<0.05
Table 2. Mean crude protein content (%) of three legume genotypes treated with molybdenum
fertilizer
Treatment
Crude Protein (%)
Cutting sequence
First Second Third Total
Legume
Kudzu 12.15 10.97 10.05
a
11.06
Calopo 11.73 10.63 8.96
b
10.44
Kudzu + Calopo 11.78 10.88 9.37
ab
10.68
Molybdenum
Without Mo 11.51 10.76 9.32 10.53
3 g kg
-1
seed 11.91 10.76 9.10 10.59
6 g kg
-1
seed 11.83 11.06 9.81 10.90
9 g kg
-1
seed 12.32 10.71 9.61 10.88
ab
Means within column with different superscripts differ at P<0.05
77
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 4
The Use of Rain Tree Pods as a Feed Supplement for Dairy Goats
Jetana, T.
1*
, S. Usawang
1
& M. Techakampu
2
1
Research and Development Centre for Livestock Production Technology,
2
Department of Obstetrics, Gynaecology and Reproduction, Faculty of Veterinary Science,
Chulalongkorn University, Bangkok 10330, Thailand
*
Email of corresponding author: [email protected]
Intr
oduction
The rain tree (Saman samanea) is a tropical legume and the pods of the rain tree are easily
available in the dry season. It is generally known that these pods have been appreciatively
eaten by cattle (Staples and Elevitch, 2006). Studies demonstrated that the rain tree pod has
the advantage of enhancing microbial growth in the rumen of buffaloes (Jetana et al.
,
2011a,b) and cattle (Jetana et al.
, 2010). The objectives of the experiment were to determine
and compare the effects of supplementation with either commercial pellets (CCP) or the
pellets produced from rain tree pods (RTPP) on the whole tract apparent digestibility of DM,
OM and fibre, ruminal microbial production, milk production, quality of milk and capital cost
of milk production.
Materials and methods
The experiment was conducted with 14 Saanen dairy goats (weighing 29.0–58.0 kg). The
anim
als were randomly divided into two groups of 7 animals each. Group 1 (38.4 0.62 kg)
was fed ad libitum with 2.46 kg corn silage (fresh weight) and supplemented with 1 kg of
CCP (fresh weight), and Group 2 (40.9
0.74 kg) was fed ad libitum with 2.46 kg corn silage
(fresh weight) and supplemented with 1 kg of RTPP (fresh weight). The crude protein content
in CCP (15.0%) and RTPP (15.2%) was similar. The CCP contained 865 g DM/kg, 31 g ash
and 440 g NDF based on g/kg DM basis while RTPP contained 764 g DM/kg, 62.3 g ash, 200
g NDF, 45.3 g phenolic compounds, 10.8 g condensed tannins, 170 g total sugar and 90 g
sucrose per kg DM basis.
Two studi
es were conducted over 35 days. The first study determined milk production
and milk quality for 35 days, whilst the second study determined the nutrient digestion and
microbial production in the rumen. The samples were collected for digestion and microbial
production in the rumen for 7 days, during day 28 to 35 of experimentation. The animals
were housed in individual pens during the experimental period with facilities for separate
urine and feces collections. The feed intake and milk production of each goat were recorded
daily and 20 mL of milk were taken as a sub-sample into each plastic container for chemical
analysis. Total fat was determined by a simple UV spectrophotometric method (Forcato et al.,
2005); milk protein was calculated by total N in milk (Micro Kjeldahl, AOAC 2000)
multiplied by 6.38. Total solids were determined by taking 10 g of milk samples in 50-ml
Erlenmeyer flasks and kept at 80ºC in a hot air oven for 24 hours. The ash in the milk
samples was determined by burning them to a constant weight in a muffle furnace at 550ºC
for 8 hours. Milk lactose was calculated by subtracting total fat, protein and ash from total
solids.
78
On day 28 to 35, urine was collected in plastic bags containing 100 mL of 7% HCl to
maintain a pH below 3. Total daily urine was weighed and sub-samples were taken, diluted 5
times with distilled water, and stored at 4ºC for PD analysis (IAEA-TECDOC-495, 1997).
Total daily faeces were weighed and sub-samples (20%) were then stored at 4 ºC for
chemical analysis. Ten percent of the representative aliquots of offered feed, refused feed and
faecal samples were collected and stored at –20ºC. At the end of each sampling period,
sampl
es from each animal were pooled and dried in a hot air oven at 65ºC, for 72 hours, prior
to analysis for dry matter (DM), ash, nitrogen (N), and neutral detergent fibre (Van Soest et
al. 1991). Fresh drinking water was provided throughout the experiments. Purine derivatives
in the urine were measured as allantoin, uric acid, xanthine and hypoxanthine and microbial-
N in the rumen was calculated using equation of Jetana et al. (2003).
Res
ults and Discussion
Table 1 shows that the RTPP intake was greater than that of CCP intake, but none of the
supplemental diets affected corn silage intakes. However, digestibility coefficients of DM
and OM were generally lower in goats in the RTPP than those in the CCP group. It is
possible that the rain tree pods contained higher available sugar (sucrose) than the CCP diet
decreasing the pH in the rumen (Hindrichsen and Kreuzer, 2009) and thus the activity of
cellulolytic microbes leading to depressed fibre digestion (Table 1) (Hoover, 1986).
Lower microbial production recorded in goats supplemented with RTPP (Table 1)
was in contrast with the reports by Jetana et al. (2010, 2011a,b) who demonstrated that a high
sugar and protein content in the rain tree pod has advantages of enhancing the efficiency of
microbial yield in the rumen of buffaloes and cattle. The contradicting results may be due to
i) different animal species used, ii) different processing methods for the rain tree pods, iii) the
rate of passage in animals fed the RTPP diet may be faster than in those fed the CCP diet
resulting in excess non-fermentable N sources in the rumen to be fermented in the hindgut,
iv)
binding of condensed tannins to available nutrients (N) in the RTPP supplemental diet and
v) the high content of tannins inhibiting some microbial activity (Waghorn, 2008). Though
the average milk production (mL/day/BW
0.75
) (Figure1) and capital cost of milk production
(US dollar/kg milk) were lower (Table 1), the contents of protein, lactose and total solids in
the milk were higher in goats supplemented with RTPP than in those supplemented with CCP
(Table 1). The high lactose in milk is not surprising as there is high sucrose in the RTPP
while the high protein in milk is probably due to the escape of tannin-protein complexes in
RTPP diet from rumen fermentation, subsequently digested in the small intestine and
absorbed for production of protein in milk.
79
Table 1. Intake, coefficient of digestion, ruminal microbial nitrogen production, milk
composition and capital cost of milk production in Saanen goats fed corn silages and
supplemented with two types of concentrate pellet
Type of concentrate pellet
SED
1
CCP RTPP
Body weight live(kg) 38.4 40.9 1.56
Metabolic body weight (kg) 15.4 16.1 0.46
Total dry matter (DM) 1.30
b2
1.44
a
0.03
Concentrate pellet DM 0.70
b
0.83
a
0.02
Corn silage DM 0.59 0.60 0.01
Total organic matter (OM) 1.22
b
1.35
a
0.02
Total neutral detergent fibre (NDF) 0.69
b
0.75
a
0.02
The coefficients of (decimal)
DM 0.76
a
0.68
b
0.02
OM 0.80
a
0.72
b
0.02
NDF 0.84
a
0.78
b
0.02
Purine derivatives in urine (mmol/day)
Allantoin 19.2 15.5 1.92
Uric acid 7.40
a
1.11
b
0.58
Xanthine + Hypoxanthine 0.89 1.01 0.11
Total Purine derivatives 27.4
a
17.6
b
1.91
MN in the rumen (N g/day)
3
29.1
a
17.2
b
2.30
Chemical composition of milk (g/kg)
Fat 45.6
42.1 4.62
Protein 34.0
b
39.7
a
2.76
Lactose 23.3
b
34.7
a
2.94
Total ash 9.56 9.97 0.50
Solids non fat 64.0
b
84.4
a
2.69
Total solids 110
b
127
a
4.88
Capital of milk produced
Milk yield (g/day) 922
a
570
b
1.92
Milk produced capital (US dollar/kg milk) 0.40
a
0.35
b
0.02
1
Standard error of difference
2ab
Values within the same row with different superscripts are significantly (P<0.05) different. Values
within the same row without superscripts are not significantly (P<0.05) different
3
Purine derivatives in milk was not included for calculation
80
Figure 1. The average milk production (mL/day/BW
0.75
) of dairy Saanen goats fed different
types of concentrate pellets.
Conclusion
The study demonstrated an approach to use natural feed resources as an alternative feed
supplement to improve the quality of milk in dairy goats. The practical implication of this
study is that it would be benefit the smallholder farmers to use rain tree pods because it
improves milk quality.
References
Forcato, D.O., M.P. Carmine, G.E. Echeverria, R.P. Pecora and S.C. Klvatinltz, 2005. Milk
fa
t content measurement by a simple UV spectrophotometric method: An alternative
screening method. J. Dairy Sci.
88: 478–481.
Hindrichsen, I.K. and M. Kreuzer, 2009. Hugh methanogenic potential of sucrose compared
with starch at high ruminal pH. J. Anim. Physio.
Anim. Nutr. (Berl). 93 (1): 61–65.
Hoove
r, W.H., 1986. Chemical factors involved in ruminal fibre digestion. J. Dairy Sci. 62:
2755
–2766.
IA
EA-TECDOC-495, 1997. “Estimation of rumen microbial protein production from purine
derivatives in the urine.” A laboratory manual for the FAO/IAEA Co-ordinated Research
programme on development, standardisation and validation of nuclear based technologies for
measuring microbial protein supply in ruminant livestocks for improving productivity,
Vienna, Austria.
Jetana, T., N. Abdullah, J.B. Liang, S. Jalaludin and Y.W. Ho, 2003. Urinary excretion of
purine derivatives as makers for development of model to estimate rumen microbial nitrogen
production in goats. 20
th
Pacific Science Congress, 17–21 March, 2003, Bangkok, Thailand.
Poster
9.
81
Jetana, T., S. Usawang, S. Thongruay, C. Vongpipatana and S. Sophon, 2010. Apparent
digestibility, nitrogen balance, ruminal microbial nitrogen production and blood metabolites
in Thai Brahman cattle fed a basal diet of rice straw and supplemented with some tropical
protein-rich trees. Asian-Aust.
J. Anim. Sci. 23: 465–474.
Jetana, T.,
C. Vongpipatana, S. Usawang and S. Thongruay, 2011a. The use of tropical
protein-rich leaves as supplements to Thai swamp buffalo receiving a basal diet of rice straw
and treated leucaena (Leucaena leucocephala). Trop. Anim. Health Prod.
43: 57–67.
Jetana, T., C. Vongpipatana, S. Usawang and S. Sophon, 2011b. Using treated leucaena
(Le
ucaena leucocephala) leaves as supplements to Thai Brahman cattle giving a basal diet of
rice straw. J. Anim. Vet. Adv.
10 (8): 1054–1060.
Khalili, H. and P. Huhtanen, 1991. Sucrose supplements in cattle given grass silage-based
diet. 2. Digestion of cell wall carbohydrates. Anim. Feed Sci. Technol.
33: 263–273.
Staples, W.G. and C.R. Elevitch, 2006. Samanea saman (rain tree) Fabaceace (legume
family). In: Traditional Trees of Pacific Islands: Their Culture, Environment, and Use.
C.R.
Elevitch (ed.), p
p. 661–674.
Van Soest, P.J., J.B. Robertson and B.A. Lewis, 1991. Methods for dietary fibre, neutral detergent fibre and non-starch polysaccharides in relation to animal nutrition. J. Dairy Sci.74:
3583
–3597.
Wa
ghorn, G.C., 2008. Beneficial and detrimental effects of dietary condensed tannins for
sustainable sheep and goat production-Progress and challenges. Anim. Feed Sci. Technol.
147:
116–139.
82
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 5
Effect of Jerusalem Artichoke Supplementation on Methanogenic Achaea
in Dairy Goats using Real Time PCR Technique
Kanokwan, K.
1
, S. Paengkoum
2
, P. Kongmun
3
, Z. Yu
4
& P. Paengkoum
1*
1
School of Animal Production Technology, Institute of Agricultural Technology, Suranaree
University of Technology, 30000 Nakhon Ratchasima, Thailand
2
Department of Animal Science and Agricultural Technology
Faculty of Animal Science and Agricultural Technology, Silpakorn University, Information
Technology Campus. 76120 Phetchaburi, Thailand
3
Department of Animal Science, Faculty of Agriculture, Kasetsart University, 10900
Bangkok, Thailand.
4
The MAPLE Research Initiative, Department of animal Sciences, The Ohio State University,
Columbus, OH 43210, USA
*
Email of corresponding author: [email protected]
Introduction
Early research on rumen methanogenic achaea focused on the reduction the loss of dietary
energy for the ruminant, but lately, the objective was to mitigate methane from enteric
fermentation to reduce environmental pollution (Hindrichsen et al., 2004). Inulin is a
polydisperse non-starch polysaccharide naturally occurring as a storage carbohydrate in some
36,000 plant species. The main sources of inulin are chicory and Jerusalem Artichoke
(Helianthus tuberosus L.) (Böhm et al., 2005). Inulin is considered as archetypal prebiotic
and has been used successfully in monogastric animals but we know of few studies to
investigate the direct effect of inulin on methanogenic achaea in rumen fluid. The objective
of the present study was to determine the effect of supplementing inulin powder from
Jerusalem Artichoke in diet on methanogenic bacteria in dairy goats using real-time PCR
technique (Yu et al., 2005).
Materials and methods
Six female crossbred Saanen (>75% pure) goats were allocated to two treatment groups. All
animals were fed with purple guinea grass (Panicum maximum
TD 58) ad libitum and
supplemented with concentrate at 1.5% BW (20% CP). In the control group no inulin was
given to the animals while in the treatment group 10% inulin from Jerusalem Artichoke
(Helianths tuberosus) was added to the diet. All animals were kept in individual pens and
received water and mineral blocks ad libitum. Rumen contents were collected on day 0, 1, 7
and 14 at post-morning-feeding and immediately used for direct total protozoa and bacteria
counts using a haemocytometer (Galyean, 1989). The DNA was immediately extracted from
the rumen content.
Community DNA was extracted from 0.2 mL aliquots of rumen fluid to which 1 mL of lysis
buffer was added and homogenised for 5 min for DNA extraction. DNA was purified using
High Pure PCR Template Preparation Kit (Roche, Germany). Species-specific primers used
83
the 16s gene, methanogens. The primer set sequences was MET630F [16S gene,
methanogens (GGATTAGATACCCSGGTAGT)] and MET803R [16S gene, methanogens
(GTTGARTCCAATTAAACCGCA)] were chosen from Christophersen (2007) and Skillman
et al., (2006). Real-time PCR amplification was done using a FastStart Essential DNA Green
Master (Roche, Germany).
Res
ults and Discussion
Populations of total protozoa and total bacteria in the rumen fluid counted under an optical
microscope are shown in Table 1. There was no significant difference among treatments
(P>0.05) in the total protozoal population at 14 day after 10% inulin treatment. The protozoal
count was 15.17 ×10
5
cell/mL rumen content after treatment compared to 12.50 × 10
5
cell/mL
rumen content for the control. Total bacteria counts and pH of the rumen of goats on day 0, 1,
7 and 14 of treatment with 10% inulin were not significantly different between groups
(P>0.05)
.
Table 1. Effect of inulin on methanogenic achaea, total protozoa and total bacteria in rumen
fluid.
Sampling
(day)
Methanogen
(×10
7
copies/mL) SEM
Total Protozoa
(×10
5
/mL)
SEM
Total Bacteria
(×10
9
/mL) SEM
control Inulin control Inulin control Inulin
0 4.19 11.85 0.89 16.50 15.83 0.92 24.93 15.27 4.19
1 4.24 6.33 2.42 6.00
a
10.17
b
1.11 16.00 12.80 1.66
7 7.57
a
14.56
b
0.26 12.83 14.00 4.37 10.00 11.67 2.63
14 10.16 9.98 0.87 12.50 15.17 3.22 6.33 9.20 1.43
a,b
Values in the same row with different superscript differ significantly (P < 0.05).
SEM = standard error of the mean.
Methanogenic bacterial diversity was investigated using real-time PCR technique. The results
showed that there were no significant differences among treatments (P>0.05) on population
of methanogens at day 14 of with 9.98 × 10
7
and 10.15 × 10
7
copies/mL, respectively, for the
treatment and control groups (Figure 1). The results indicate that addition of 10% inulin did not affect the population of methanogens in the rumen of dairy goats.
Fig
ure 1. Populations of the rumen methanogens of goats treated with 10% inulin.
The rumen fluid samples were collected at days 0, 1, 7 and 14 after post-morning-feeding.
84
References
Böhm, A., I. Kaiser, A. Trebstein and T. Henle, 2005. Heat-induced degradation of inulin.
Eur.
Food Res. Technol. 220, 466–471.
Christophersen, C.T., 2007. PhD Thesis. University of Western Australia, Perth.
Galyean, M., 1989. Laboratory Procedure in Animal Nutrition Research. Department of
Animal and Range Sciences, New Mexico State University, U.S.A.
Hindrichsen, I. K., H.R. Wettstein, A. Machmüller, C.R. Soliva, K.E. Bach Knudsen, J.
Madsen and M. Kreuzer, 2004. Effects of feed carbohydrates with contrasting properties on
rumen fermentation and methane release in vitro. Can.
J. Anim. Sci. 84: 265–267.
Skillman, L.C., P.N. Evans, C. Strompl and K.N. Joblin, 2006. 16S rDNA directed PCR
primers and detection of methanogens in the bovine rumen. Lett. Appl. Microbiol. 42
: 222
–
228.
Yu, Z., F.C. Michel, G. Hansen Jr., T. Wittum and M. Morrison, 2005. Development and
application of real-time PCR assays for quantification of genes encoding tetracycline
resistance. Appl. Environ. Microbiol.
71: 6926–6933.
85
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 6
Production and Quality of Pasture with Introduced Legumes
for Dairy Goats
Karti, P.D.M.H.K.
*
, L. Abdullah, D.A. Astuti, N. Kurniaty & R. Nissa
Fac
ulty of Animal Science, Bogor Agricultural University, Bogor, West Java
16680. Indonesia
*
Email of corresponding author: [email protected]
Introduction
Goats can consume a wide variety of forages and consuming good quality forages will result
in higher milk production in dairy goats. The feeding of legume forage species will increase
the compliance with the protein needs of dairy goats. Uptake of minerals including N, P, and
Ca from the soil can increase the quality of forage (Karti, 2010). In ruminants, volatile fatty
acids (VFA) contribute up to 70% of the caloric requirement (Bergman, 1990) and
fermentability of organic matter can be measured by its VFA production (Despal et al., 2011)
while protein by its NH3 production. The latter can be assimilated by rumen microorganisms
for growth and other production functions of the host animals. The purpose of this study was
to de
termine the effect of introducing legume intercropping with Brachiaria humidicola in
pasture for feeding of dairy goats.
Materials and methods
The plant materials used were B. h
umidicola pasture with three kinds of legumes namely
Pueraria javanica, Centrosema pubescens and Calopogonium
mucunoides. The
NPK
fertiliser, manure and soil potential microorganisms used for this study were obtained from
the Agrostology Laboratory, Faculty of Animal Science, Bogor Agricultural University. The
experiment used a randomised block design with eight treatments and four replicates. The
treatments were P1: Control (pasture consists of only Brachiaria humidicola); P2: B.
humidicola combined with Pueraria javanica
, Centrosema pubescens and Calopogonium
mucunoides with NPK fertiliser; P3: B. Humidicola with P. javanica, P4: B. Humidicola
with
C. p
ubescens; P5: B. Humidicola with C. mucunoides; P6: B. Humidicola with P. Javanica
and
C. pubescens; P7: B. Humidicola with P. javanica and C. mucunoides and P8: B.
humidicola with P. javanica, C. pubescens and C. mucunoides. Treatment P3 to P8
were given
NPK at half doses, manure and potential soil microorganisms. The data were analysed using
ANOVA and the differences between mean treatments were analysed using the Duncan
Multiple Range Test (DMRT).
Results and Discussion
Dry matter production and P and
K uptakes of plants were significantly increased
with the
introduction of legumes (P2–
P8) compared to the control.
Production of DM in treatments
with half doses of inorganic fertiliser, manure and potential
microorganisms (P3, P5, P6, P7
86
and P8) were significantly higher than that
using the inorganic fertiliser alone (P2). Uptakes
of
N and Ca in the treatment with half doses of the inorganic fertiliser, manure and
potential
microorganisms (P3–
P8) were significantly higher than using inorganic fertilizer only (P2).
Uptakes of Mg from P3 and
P7 were significantly higher than those in P1, P2 and P4. The best
treatment
was P7, followed by P3, P5 and P8 for DM production and mineral uptake (Table 1).
The results showed that the introduction of legumes with B. humidicola pasture (P2-
P8) increased (P<0.05) the DM digestibility, VFA and NH3, while no difference was observed
among treatments on organic matter digestibility. The treatment which combined NPK
fertilisers with manure and potential microorganisms (P7, P8, and P5) significantly (P<0.05)
increased the digestibility of DM, VFA, and NH3 compared to the control (Table 1). The total
VFA produced in this study was between 82.65 to
153.04 mM which is
sufficient for the
optimal growth of rumen microorganisms. The total VFA from a single feed with legume
browse plants was higher than the legume browse mixed with grass (Astuti et al., 2011).
The NH3 produced from protein fermentation in the experiment was sufficient for the
growth of dairy goats as reported by Despal et al. (2011).
Table 1. The effect of introducing legumes on DM production, N, P, K, Ca and Mg uptake
of plants, DMD, OMD, VFA and NH3
Treat-
ments
DM Prod
(g/0.25 m
2
)
Uptake of plant (mg/0.25 m
2
) Variables
N P K Ca Mg
KCBK
(%)
KCBO
(%)
VFA
(mM)
NH3
(mM)
P1 37.5
d
80.5
c
6.1
c
73.9
d
18.2
d
31.9
bc
43.3
c
47.2 82.7b 7.9
c
P2 110.7
c
116.2c 18.8
ab
210.3
bc
32.1
d
28.8
c
57.2
a
55.9 153.0
a
16.5
a
P3 171.2a 287.7
a
20.6
a
313.4
a
73.6
b
51.4a 52.5
b
51.5 108.3
b
13.4
b
P4 108.5
c
213.8
b
14.1
b
150.9
c
69.5
c
24.9
c
56.4
a
54.3 108.3
b
13.7
b
P5 171.8
a
235.3
ab
20.6
ab
307.4
ab
70.4
b
37.8
ab
54.3
a
53.1 141.4
a
12.7
b
P6 148.0
b
192.5
b
14.8
ab
156.9
c
57.7
c
44.4
ab
54.3
a
53.9 87.3
b
15.9
a
P7 175.2
a
268.1
a
19.3a 271.6
ab
94.6a 52.6
a
53.9
a
52.8 131.0
a
15.1
a
P8 156.6
b
223.9
a
12.5
bc
230.2
b
86.1a 32.9
bc
54.1
a
52.1 116.7
a
14.9
a
Notes: The treatments were P1: Control (Pasture consists of Brachiaria humidicola), P2: B. Humidicola with
Pueraria javanica, Centrosema pubescens and Calopogonium mucunoides with fertiliser NPK), P3: B.
humidicola with P. javanica, P4: B. humidicola with C. pubescens, P5: B. Humidicola with C. mucunoides, P6:
B. Humidicola with P. javanica and C. pubescens, P7: B. Humidicola with P. javanica and C. mucunoides, P8:
B. humidicola with P. javanica, C. pubescens and C. mucunoides. DMD = dry matter digestability, OMD =
organic matter digestability. Different superscripts within column show significant differences (P <0.05).
Conclusion
The introduction of legumes with B. humidicola pasture increased DM production, mineral
uptake (N, P, K, Ca and Mg), DM digestibility, VFA and NH3 produc
tion (P3– P8). Dry matter
production, mineral uptake in treatments with half doses of inorganic fertilisers, manure and
soil potential microorganisms (P 3–P8)
higher than using inorganic fertiliser (P 2) and
c
ontrol (P1). Treatments P7, P8, and P5 increased DM digestibility and VFA and NH3
production compared to the control. The best treatment in this study was P7 (B. humidicola
pasture with P. javanica and C. mucunoides) followed by P8 (B. humidicola pasture with P.
javanica, C. pubescens
and C. mucunoides).
87
References
Astuti, D.A., A.S. Baba and I.W.T. Wibawan, 2011. Rumen fermentation, b
lood metabolities
and
performance of sheep fed tropical browse plants. Med. Pet. 34 (3): 201–206.
Bergman, E.N., 1990. Energy contributions of volatile fatty acids from the gastrointestinal
tract in various species. Physiol. Rev.
70: 567–590.
Despal, T., I.M.L. Hutabarat, R. Mutia and I.G. Permana, 2011. The evaluation of nutrient
quality of ramie leaves silage and hay in complete mixed ration for Etawah-Crossbreed goat
using in vitro technique. Indon. J. Nutr. Feed Sci., 2 (1):
26–31.
Karti, P.D.M.H., 2010. Development of drought resistant grasses and legumes through a
quick
selection technique and efficient management. The Conference of the Research Result
on im
proving the Agricultural Production in the Tropic. Research Institutions and
Community Empowerment. Bogor Agricultural University.
88
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 7
Evaluation of Tree Leaves as a Crude Protein and Energy Supplement to
the Low Quality Diets of Dairy Goats
Khan, N.A.
1*
, G. Habib
2
, Altaf-Ur-Rehman
1
, M. Suleman
1
& G. Ullah
3
1
Khyber Pakhtunkhwa Agricultural University Peshawar, 25130, Khyber Pakhtunkhwa,
Pakistan
2
Livestock and Dairy Development Department, Civil Secretariat Punjab, Lahore, Pakistan
3
Livestock and Dairy Development Department, Peshawar, Khyber Pakhtunkhwa,, Pakistan
*
Email of c
orresponding author: [email protected]
Introduction
Goats are predomiantly raised on natural pastures or stall-fed on low quality hay and crop
residues in many developing countries, including Pakistan. In Pakistan, transhumant,
nomadic and sedentary farming are the common goat production systems, where goats are
extensively grazed on natural rangelands. In the last few decades, the carrying capacity of
these pastures have deteriorated due to continuous overgrazing, recurrent droughts and lack
of range improvement practices. In addition to the declining quantity, quality of the surviving
pasture has deteriorated due to over-utilisation and a consequent depletion of highly palatable
and nutritious forage species. The year-round feed availability in these rangelands also
fluctuates with a prolonged winter and summer feed scarcity periods. During the pasture
scarcity periods, goats are stall-fed on low quality rangeland-hay and crop residues. These
low quality diets impede goat productivity due to low dry matter (DM) intake, digestibility
and overall feeding value. Alternatively, supplementation of these low quality forages with
CP and energy rich tree-foliages can enhance DM intake, digestibility and milk yield in goats.
Our previous studies revealed that Grewia oppositifolia and Ziziphus mauritiana have better
nutrient composition among 14 promising fodder trees, and are well adapted to Pakistan‟s
arid and semi arid regions. However, the feeding value of local tree leaves needs to be
evaluated due to the negative affect of tannins on palatibility, DM digestibility and
bioavliability of dietary protein. The present study was therefore designed to investigate the
potential of G. oppositifolia and Z. mauritiana leaves as CP and energy supplement to the
low quality diets of goats.
Materials and methods
The leaves of G. oppositifolia and Z. mauritiana
were harvested in a single batch and dried in
shade, mixed, and transported to the Livestock Research Station Mansehra, Pakistan, for the
experimental studies. Ruminal CP degradability kinetics of the supplements were determined
by the method of Khan et al. (2009), using three mature Beetal bucks fitted with permanent
ruminal cannulae. Lactation responses to the supplements were tested with sixteen Beetal
goats (Average BW = 44.56 ± 4.20 kg). The goats were grazed on the natural pasture as a
single flock and supplemented with dried leaves of Z. mauritiana (490 g), G. oppositifolia
(415 g), a mixture of Z. mauritiana (245 g) and G. oppositifolia (210 g) or cottonseed cake
(CSC; 250 g) on iso-nitrogenous basis for 10 weeks. Milk yield was recorded daily, and
89
samples of feed and milk were collected weekly. The DM content of feed samples was
determined by oven drying at 103°C for 24 h (6496; ISO, 1999), and CP (6.25 × N) was
determined using the Kjeldahl method (ISO 5983; ISO, 2005). Tannins were analysed by the
method de
scribed by Khan et al. (2009). Milk samples were analysed for total solids and
protein (6.38 × N) according to AOAC (1995). Fat contents in fresh milk samples were
determined using Gerber method. Solid not fat was calculated by subtracting fat contents
from the total solids. In sacco degradability, milk production and composition data were
analysed with the PROC GLM procedure in Statistical Analysis System.
Results and Discussion
The mean (n = 12) CP content of Z. mauritiana,
G. oppositifolia and CSC were 141, 165 and
269 g/kg DM, respectively. Contents of condensed tannins were higher (P<0.01) in the Z.
mauritiana (33 g/kg DM) than G. oppositifolia (0.6 g/kg DM). Leaves from G. oppositifolia
were appreciably high (35 g/kg DM) in Ca. Due to high content of condensed tannins, Z.
mauritiana leaves had the lowest rate (P<0.001) of degradation (0.11/h) and effective
degradability of CP (620 g/kg) at rumen outflow rates of 0.06. Cotton seed cake had the
highest rate (0.17/h) of degradability, and effective degradation of CP (780 g/kg). The leaves
of G. oppositifolia were intermediate in the degradation kinetics. Daily milk yield differed
(P<0.001) among the supplements (Table 1). The high bypass CP in Z. mauritiana were
efficiently utilised by goats as shown by the high (P<0.05) milk yield. Nevertheless, G.
oppositifolia and CSC were not significantly different in milk production parameters. Among
the supplements a high (P<0.05) milk fat content of 5.6 g/100 g milk was recorded with CSC
and
G. oppositifolia.
Table 1. Mean yield of milk and milk composition of Beetal goats
Parameters Z. mauritiana G. oppositifolia CSC Mixed leaves SEM Significance
Milk yield (g/d) 569
a
459
b
445
b
458
b
14.7 ***
Protein % 3.6 3.7 3.4 3.5 0.72 NS
Fat % 5.2
ab
5.6
a
5.6
a
5.0
b
1.98 *
Total solid % 12.5 12.9 13.2 12.3 2.44 NS
Solid not fat% 7.5 7.3 7.9 7.4 2.87 NS
abc
shows significant (P<0.05) differences between diets; * P<0.05; *** P<0.001; NS, non-significant (P>0.05);
SEM, standard error of means.
Conclusions
The CP in Z. mauritiana, with approximately 3% condensed tannin (33 g/kg DM), degraded
slowly and provided high bypass CP which resulted in higher milk yield. G. oppositifolia and
CSC were not significantly different in milk production parameters. Leaves from Z.
mauritiana and
G. oppositifolia trees could be conserved by drying and fed as a supplement
to minimise the production losses that invariably occur during the prolonged feed scarcity
period in the tropical arid and semi arid regions.
References
AOAC, 1995. Official Method of Analysis, 16th ed. Animal Feeds: Association of Official
Analytical Chemists, Arlington, VA, USA, pp. 1–18.
90
Khan, N.A., G. Habib and G. Ullah, 2009. Chemical composition, rumen degradability,
protein uti
lisation and lactation response to selected tree leaves as substitute of cottonseed
ca
ke in the diet of dairy goats. Anim. Feed Sci. Technol.
154: 160–168.
91
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 8
As
sessment of Grewia oppositifolia Leaves as Crude Protein Supplement to
Low Quality Diets of Goats
Khan, S.
1
, N.A. Khan
1*
, G. Habib
2
,
M.S. Qureshi
1
& A. Sultan
1
1
Khyber Pakhtunkhwa Agricultural University Peshawar, 25130, Khyber Pakhtunkhwa,
Pakistan
2
Livestock and Dairy Development Department, Civil Secretariat Punjab, Lahore, Pakistan
*
Email of corresponding author: [email protected]
Introduction
Goats are characterised by their efficient grazing behaviour and functional digestive system
and thrive well under the tropical arid and semi-arid regions. Compared to other farm animals,
the population
of goats has increased rapidly in the harsh environmental and feed scarcity
zones of the tropics. For example, in Pakistan the number of goats has increased from 29.9
mill
ion in 1986 to 59.8 million in 2011. This population growth is attributed to the drastic
changes in the pattern of range-based feed resources in the country over this period. Recurrent
droughts with concomitant overgrazing have severely affected vegetation growth in the natural
pastures. Shrubs and trees stay behind as the dominant surviving fodder species that are better
utilised by goats compared to other livestock species. Under these harsh environmental and
feeding zones, goats play a vital role in providing a livelihood to poor smallholder or landless
farmers. However, the productivity of goats is very low, as they are mostly grazed on low
quality pastures. Moreover, the year-round feed availability in the rangelands fluctuates with
prolonged winter and summer feed scarcity periods. Alternatively, goats are stall fed on crop
residues a
nd lower quality range hay (Davendra et al., 2000). These lower quality forage based
diets impede the productive performance of goats. Leguminous tree foliage being rich in
fermentable organic matter, protein and minerals could be used as a supplement to these low
quality diets; and enhance their intake, digestibility and animal performance. Grewia
oppositifolia is one the promising fodder trees, well-adapted to the arid, hilly, and semi-hilly
regions of South Asia. The present study was therefore designed to investigate the potential of
G. oppositifolia leaves as a low-cost crude protein (CP) supplement to the low-quality forage
diets of growing goats.
Materials and methods
Leaves of G. oppositifolia were harvested from communal rangelands over the harvesting
season (December to March) at 30-day intervals, dried in shade, mixed, and transported to the
Animal Research Facilities of Agricultural University Peshawar for the studies. To
investigate the effect of G. oppositifolia supplementation of dry matter (DM) intake,
digestibility and N retention in goats, a balanced trial was conducted with four mature Beetal
Buc
ks (48 ± 2.3 kg BW) in a 4 × 4 Latin square design. The animals were fed with a basal
diet of chopped sorghum hay (CP 47.8 ± 3.45 g/kg DM) ad libitum. The basal diet was
supplemented with cottonseed cake (CSC) or the CSC was replaced at the rates of 0.50, 0.75,
and 1.00 g/g with G. oppositifolia leaves. The animals were housed in individual metabolic
92
crates with a device fitted for the separate collection of feaces and urine. The animals were
adapted to the diets for 10 days, and data and samples were collected daily in the last 5 days
of each period. To evaluate changes in BW gain in response to the supplements, 32 (26 ± 3
kg BW; 10 ± 1 month of age) grazing goats were randomly assigned to four diets for 3
months. The grazing goats were supplemented with CSC or the various combinations of
CSC: G. oppositifolia leaves. Animals were weighed every 2 weeks to determine BW
changes. The samples were air dried at 70°C, ground to 1 mm; and analysed for the DM
content
by oven drying at 103°C for 24 h (6496; ISO, 1999) and CP (6.25 × N) by the
Kjeldahl method (ISO 5983; ISO, 2005). The mineral contents were determined as described
elsew
here by Khan et al. (2011). Data were analysed with the PROC GLM procedure in
Statistical Analysis System (SAS, Version 9.2).
Results and Discussion
Grewia oppositifolia leaves maintained a higher CP content (>164 g/kg DM) during the
harvesting period. The leaves were rich in Ca and K with average values of 41 and 89 g/kg
DM, respectively. The leaves were also a good source of micro-minerals Zn (41 mg/kg DM),
Fe (32 mg/kg DM), and Mn (202 mg/kg DM). Intakes of hay and total DM and digestibility
in goats did not differ with the stepwise substitution of CSC with G. oppositifolia leaves.
Goats retained the N in each diet, however, quantitatively N retention did not differ among
the diets
(Table 1). Addition of the leaves increased BW gain in the grazing goats (P<0.05).
Among the supplemented groups, lambs fed with G. oppositifolia leaves showed higher BW
gain (124 g/day).
Conclusions
The results demonstrated that G. oppositifolia leaves provide good quality green fodder
during the prolonged winter feed scarcity period, and that the leaves can be efficiently
utilised as a CP supplement for the low-quality diets of sheep.
R
eferences
Khan, N.A., G. Habib and G. Ullah 2012. Assessment of Grewia Oppositifolia leaves as feed
supplement: nutrient composition, protein degradability, N metabolism and growth rate in
sheep
. Tropical Animal Health and Production. 44: 1375–1 381.
Table 1. Dry matter (DM) intake, apparent DM and CP digestibility, and N
retention in response to substitution of cotton seed cake (CSC) with Grewia
oppositifolia leaves
CSC: G. oppositifolia SEM
100: 0 50: 50 25: 75 0: 100
DM intake g/d 611 612 618 709 63.1
DM digestibility g/kg 480 496 500 484 22.3
CP digestibility g/kg 664 644 629 614 26.4
N retained g/d 6.11 6.08 6.19 6.67 0.923
BW gain g/d 90.6
b
110
ab
114
ab
124
a
11.4
Values are means; SEM = standard error of the mean.
a,b
means with different superscripts are significantly different (P<0.05)
93
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 9
Effect of Intersowing Italian Ryegrass (Lolium multiflorum) with Dwarf
Napier Grass on Yield and Quality for Biomass Use
Khairani, L.
1, 2*
, Y.
Ishii
3
, S. Idota
3
, R.F. Utamy
4
& A. Nishiwaki
3
1
Graduate School of Agriculture, University of Miyazaki, Japan,
2
Laboratory of Forage
Crops, Faculty of Animal Husbandry, Universitas Padjadjaran, Jatinangor, Indonesia,
3
Faculty of Agriculture, University of Miyazaki,
4
Interdisciplinary Graduate School of
Agriculture and Engineering, University of Miyazaki, Miyazaki, Japan.
*
Email of corresponding author: [email protected]
Introduction
Intersowing of Italian ryegrass (Lolium multiflorum Lam, extremely early-maturing variety,
Hanamiwase) with dwarf Napier grass (Pennisetum purpureum Scumach) was examined for
yield and fibre quality in April-harvested Italian ryegrass as biomass use under 2 cutting
frequencies and 3 planting densities of dwarf Napier grass to obtain the best frequency and
density of Napier grass at the establishment year.
Materials and methods
The study was conducted on Andisols in the Kibana Field, University of Miyazaki, located at
51 m above sea level in southern Kyushu, Japan (31° 82‟N and 131° 41‟E). The trial was
conducted from November 2009 to April 2010 and temperature and rainfall data were
monitored via Miyazaki Meteorological Observatory. Plots were arranged in a randomised
complete design with 3 replications (main plots) and each subplot (plant density) had 4 rows,
at 4-m long × 5-m width with 1-m and 2-m spacing between subplots and main plots,
respectively (Khairani et al., 2011). The seeds of Italian ryegrass cv Hanamiwase (Snow
brand seed) were sown at 2 g/m
2
into the inter-row space of dwarf Napier grass plot which
had different planting densities (1, 2 and 3 plants/m
2
) on 14 November 2009. Plots were
occupied in the same ratio by both Italian ryegrass and dwarf Napier grass. Plots were rain-
fed and fertilised two times on 14 November 2009 and 2 March 2010 using chemical
compound fertiliser at the rate of 10 g N, P2O5
and K2O, each m
2
/yr.
The grass was measured for plant height, plant length and tiller number before harvest
on 5 April 2010 by cutting at 5 cm above the soil surface using a quadrant of 50 cm 50 cm.
Herbage mass was measured for fresh and dry weights. The fresh yield (g/m
2
) of Italian
ryegrass was calculated as follows: (1) Plant spacing at 1 and 2 plants m
2
of dwarf Napier
grass was calculated by yield of quadrant 2, because the area of dwarf Napier grass was
calculated at 0.25 and 0.5 m
2
for 1 and 2 plant/m
2
, respectively (2) Plant spacing at 3 plants
m
-2
of dwarf Napier grass was calculated by yield of quadrant 1, because the area of dwarf
Napier grass was 0.75 m
2
for 3 plants/m
2
. The dry matter (DM) yield was calculated
according to Tarawali et al. (1995).
Samples were analysed in duplicates for in vitro dry matter digestibility (IVDMD),
neutral detergent fibre (NDF), acid detergent fibre (ADF) and acid detergent lignin (ADL)
contents using a detergent digestion protocol as described by Vogel et al. (1999). Samples
94
were processed by the fibre extraction protocol (Vogel et al., 1999), and the ANKOM
proc
edure (ANKOM 220 Fibre Analyser, Model 220v). IVDMD content was determined by
the pepsin-cellulase digestion method (Goto and Minson, 1977).
One-way Analysis of Variance (ANOVA) was carried out using SPSS (version 15.0)
and mean separation was tested using the least significance difference (LSD) method at 5%
significance level. Pearson correlation coefficients were calculated among growth attributes,
DM yield, cell wall components and IVDMD (for each parameter, total n = 36).
R
esults and Discussion
Dry matter yields of Italian ryegrass were significantly (P<0.05) higher, where it was sown at
1 plant/m
2
(1.926
–1.931 Mg/ha) and 2 plants/m
2
(1.891–1.899 Mg/ha) of dwarf Napier grass
plot than sown at 3 plants/m
2
(0.820
–1.146 Mg/ha), while the NDF, ADF and ADL contents
ranged from 50.4–54.7%, 36.4–38.6% and 6.8–8.3%, respectively. The increase in plant
de
nsity led to significantly (P<0.05) decreased tiller number, fresh and DM yield, and
IVDMD of Italian ryegrass with no significant difference in fibre or structural carbohydrate
compositions in Italian ryegrass (P>0.05).
Table 1. Correlation coefficients of growth attributes
†
, yield
†
, yield components
†
,
chemical
compositions
†
and in vitro dry matter digestibility
†
of Italian ryegrass
Ethanol
production
potential PH PL TN FY DMY NDF ADF ADL
PH ns –
PL ns .596** –
TN .759** -.346* ns –
FY .953** ns ns .829** –
DMY .973** ns ns .815** .976** –
NDF ns ns .374* ns ns ns –
ADF ns .357* .412* ns ns ns ns –
ADL ns ns ns ns ns ns ns .707** –
IVDMD ns ns ns ns ns ns -.331* ns ns
†
PH, plant height; PL, plant length; TN, tiller number; FY, fresh yield; DMY, dry matter yield; NDF, neutral detergent fibre;
ADF, acid detergent fibre; ADL, acid detergent lignin; IVDMD, in vitro dry matter digestibility.
* Significant at P<0.05, ** significant at P<0.01 by Pearson‟s correlation analysis (n = 36), ns at P>0.05.
Conclusions
Dry matter yield, cellulose and hemicellulose contents of Italian ryegrass decreased
significantly (P<0.05)
with increased plant density of dwarf Napier grass
Reference
s
Goto, I. and D.J. Minson, 1977. Predicting of the dry matter digestibility of tropical grasses
using a pepsin-cellulase assay. Anim. Feed Sci. Technol.
2: 247–253.
Khairani, L., Y. Ishii, S. Idota, R.F. Utamy, A
. Yamano and A. Nishiwaki,
2011. Effect of
plant density and cutting frequency of dwarf Napier grass, combined with intersowing Italian
ryegrass on dry matter yield and quality for biomass use in southern Kyushu, Japan. Japan
J.
Grassl. Sci. 57
(Suppl).
95
Tarawali, S.A., Tarawali, G., Larbi, A. and
J. Hanson, 1995. Methods for the
evaluation of
legumes, grasses and fodder trees for use as livestock feed. ILRI Manual 1. International
Livestock Research Institute (ILRI), Nairobi, Kenya, 7.
Vogel, K.P., Pedersen, J.F., Masterson, S.D. and J.J. Toy, 1999. Evaluation of a filter bag
system for NDF, ADF, and IVDMD forage analysis. Crop Sci.
39: 276–279.
96
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 10
Effect of Feeding Pattern on Rumen Microorganism
Population in Saanen Goats
Thongruang, S.
1
, S
. Paengkoum
2
& P.Paengkoum
1*
1
School of Animal Production Technology, Institute of Agricultural Technology, Suranaree
University of Technology, Nakhon Ratchasima, 30000, Thailand.
2
Faculty of Animal Sciences
and Agricultural Technology, Silpakorn University, Cha-am, Phetchaburi, 76120, Thailand.
*
Email of c
orresponding author: [email protected]
Introduction
Rumen microorganisms, especially the methanogenic bacteria and protozoa are the main
contributing factors of enteric methane production, which contributes to the overall
production of greenhouse gas (GHG) in the atmosphere causing global warming. Factors
influencing ruminal methanogen production include; level of intake, type and quality of feed
and environmental temperature (Shibata and Terada, 2010; Mirzaei-Aghsaghali and Maheri-
Sis, 2011), but limited studies have been conducted to examine the effect of feeding system
(e.g. cut-and-carry (pen-feeding) vs. grazing) on the population of ruminal methanogens.
M
aterials and methods
Six female crossbred Saanen goats (12 months, 30.5 ± 5 kg) were divided equally into two
groups; cut-and-carry (pen-feeding) and grazing systems. All animals in the cut-and-carry
group
were fed ad libitum with purple guinea grass (Panicum maximum
TD58) as basal
roughage. Animals in the grazing group were allowed to graze between 0900
to 1800h
(continuous grazing at a stocking rate of 3 goats/200 m
2
). Concentrate
feed was offered at a
restricted amount of 1.5% BW (20% CP) at 0830 h daily. Rumen content of each animal was
collected using a suction pump 4 h after the goats were fed the concentrates on days 0, 1, 7
and 14. Rumen contents were processed for the quantification of 16S gene copies of
methanogens archaea using real-time PCR assay(LightCycler
®
Nano System version 1.0,
Roche). Microscopic direct counting of the total bacteria and protozoa population was also
carried out. Statistical analyses were conducted using SAS (1989) v6.12 and differences
between means considered to be significant at P<0.05.
Results and Discussion
For the grazing goats, the average methanogenic archaes at day 14 was 3.36 × 10
7
copies/mL
rumen content, which was significantly lower (P<0.05) than in the cut-and-carry goats (10.15
×
10
7
16S rRNA copies/mL rumen content) (Figure 1). Populations of rumen protozoa and
bacteria of grazing goats were not significantly different from those of goats fed by cut-and-
ca
rry (Table 1). Rumen pH of grazing goats (7.70) was higher (
P<0.05) than that of the cut-
and
-carry goats (6.70). Feed intake of concentrates was not significantly different (P<0.05)
between cut-and-carry goats (464.86 gDM) and grazing goats (479.86 gDM). The CP of
97
purple guinea grass for grazing goats (8.81%) was not significantly different (P>0.05) from
that of the cut-and-carry goats (10.12%). NDF
content (67.04%) of grass for cut-and-carry
was significantly (P <0.05) higher than that for grazing goats (60.65%) because grazing goats
can select to consume good quality grass of lower NDF than that those in the cut-and-carry
sy
stem. Since fibre content has a major effect on ruminant methane emissions (Graeme et al.,
2000)
it might be possible that grazing goats produce less methane than the cut-and-carry
goa
ts as indicated by the lower counts of methanogens in the grazing goats.
Table 1. Some rumen microorganism parameters in cut-and-carry and grazing Saanen
goats.
Day
Feed of Goats
SEM
Cut-and-carry Grazing
Bacteria 0 24.93 × 10
9
15.73 × 10
9
2.43
(cells/mL rumen content) 1 16.00 × 10
9
16.27 × 10
9
1.43
7 10.00 × 10
9
09.67 × 10
9
1.15
14 06.33 × 10
9
04.73 × 10
9
1.08
Protozoa 0 16.50 ×10
5
14.33 × 10
5
1.58
(cells/mL rumen content) 1 06.00
b
× 10
5
17.33
a
× 10
5
1.82
7 12.83 × 10
5
12.50 × 10
5
1.97
14 12.50 × 10
5
11.33 × 10
5
1.54
Methanogens 0 04.19
a
× 10
7
01.10
b
× 10
7
0.31
(16S rRNA gene
copies/mL rumen content)
1 04.23
a
× 10
7
01.59
b
× 10
7
0.28
7 07.57
a
× 10
7
04.50
b
× 10
7
0.25
14 10.16
a
× 10
7
03.37
b
× 10
7
0.57
Values with different small superscript letters in the same column are significantly different (P<0.05)
Figure 1. Methanogen counts of cut-and-carry and grazing goats.
References
Graeme, N.J., C. Strompl, D.M. Burgess, L.C. Skillman, E.R.B. Moore and K.N. Joblin,
2000. Isolation and identification of ruminal methanogens from grazing cattle. Curr.
Microbiol. J. 40
: 327–332.
Mirzaei-Aghsaghali, A. and N. Maheri-Sis, 2011. Factors affecting mitigation of methane
emission from ruminants I: feeding strategies. Asian J. of Anim. Vet.
Adv. 6 (9): 888–908.
98
SAS, 1989. SAS User‟s guide : statistics. Version 6.12. SAS Inst. Inc., Cary, NC, USA.
Shibata, M. and F. Terada, 2010. Factors affecting methane production and mitigation in
ruminants. Anim. Sci.
J. 81: 2–10.
99
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 11
Supplementation of Leucaena and Acacia mangium Willd Foliages on
Microbial N Supply, Digestibility and N Balance in Saanen Goats
Traiyakun, S.
, A. Petlum, J. Khotsakdee & P. Paengkoum
*
School of Animal Technology, Institute of Agriculture Technology
Suranaree University of Technology, Muang, Nakhon Ratchasima, 30000, Thailand
*
Email of corresponding author: [email protected]
Introduction
Locally available feed resources, particularly crop residues, protein foliages and agro-
products should be utilised to cut production cost and to meet the increasing demand feed for
animal production. Ruminant feeding systems based on poor quality roughage where protein
is one of the first limiting factors may require additional protein to maintain an efficient
rumen ecosystem that will stimulate nutrient intake and improve animal performance
(Preston and Leng, 1987). The purpose of this study was to evaluate the effectiveness of
supplementing dairy goats with protein foliages such as Leucaena and Acacia mangiumWilld
in a rice straw-based diet.
Materials and methods
Twelve Saanen goats selected from a commercial farm based on similar body weight (27.0 ±
3.5 kg) were used for this study. The goats were housed in individual pens and allowed 3
weeks to adapt to experimental conditions. The goats were randomly allocated to three
treatment groups in a 3 x 3 Latin square experiment (replicated 4 times). Each goat was given
rice straw as roughage plus the respective treatment diet. The diets were iso-nitrogenous and
iso-energetic containing cassava pulp, molasses, urea and commercial mineral and vitamin
mix. The experimental treatments were (i) soybean meal (SBM), (ii) partial substitution of
SBM with Leucaena (Leucaena leucocephala) foliage or (iii) partial substitution of SBM
with Acacia mangium Wi ll
d foliage.
Results and Discussion
Microbial N supply in terms of microbial N yield (gN/d) and the efficiency of microbial
synthesis (gN/kg DOMR), and microbial protein synthesis (gCP/d) among the treatment
groups were not significantly (P>0.05) different (Table 1).
Replacing Leucaena and Acacia mangium Willd did not significantly affect average
nutrient and digestible nutrient intakes, except, as expected, that total tannin and condensed
tannin intakes of goats fed Leucaena foliage, were higher (P<0.05)
than those of Acacia
mangium
foliage and SBM.
100
Table 1 Effect of soybean meal substitution with foliages on digestible organic matter intake
(DOMI), microbial N supply and proportion of microbial protein synthesis in dairy goats.
Dietary treatments
SEM Control Leucaena Acacia mangium Willd
DOMI, kg/d 1.3 1.2 1.2 0.03
Digestible nutrient intake, kg/d
Organic matter 1.25 1.21 1.20 0.058
Crude protein 0.20 0.20 0.19 0.009
Neutral detergent fiber 0.57 0.59 0.59 0.019
DOMR, kg/d * 0.8 0.8 0.8 0.02
Microbial N supply
gN/d 15.0 14.6 13.9 0.32
gN/kgDOMR 18.7 18.7 18.6 0.64
Microbial protein, gCP/d 93.6 91.3 86.6 1.97
* DOMR = digestible OM fermented in the rumen, calculated as 0.65 x DOM intake (ARC, 1984)
SEM = standard error of means.
The present results indicate that local protein foliages from shrubs and trees can
substitute imported feedstuffs such as SBM as protein supplement for dairy goat production.
Reference
s
Preston, T.R. and R.A. Leng, 1987. Matching Ruminant Production Systems with Available
Resources in the Tropics and Subtropics. Armi
dale, Australia, Penambul Books.
SAS, 1985. User‟s Guide: Statistic, Versions 5. Edition SAS. Inst. Cary, NC.
101
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 12
Enhancing Performance of Dairy Goat by Biscuit Feeding as Fibre Source
Retnani, Y.
Laboratory of Feed Industry, Department of Nutrition and Feed Technology
Faculty of Animal Science, Bogor Agricultural University
Jl. Agatis, Kampus Darmaga, Bogor 16680, Indonesia
Email of corresponding author: [email protected]
Introduction
Dairy goat farming in Indonesia is an activity that has potential to be developed. The milk of
dairy goats is of better quality than cow milk and fetches a higher price. The problem often
encountered in the dairy goats is low milk yield of less than 2 L/head/day. Productivity of
dairy goats is largely determined by the availability and quality of feed. The major constraints
of ruminant feed are as follows: forage is bulky and perishable thus difficult to handle,
distribute and process; inconsistent supply between dry and rainy seasons; low palatability
and low digestibility. Therefore, it is necessary to develop suitable technologies to produce
ruminant feed which is more durable, easier to handle, distribute and feed to animals.
B
iscuit is a dry product that is relatively long-lasting under normal storage conditions
and easy to handle (Whiteley, 1971). To date no research has been conducted on the
processing of forage into forage biscuits which can be used during feed scarcity for dairy
goats in the dry season.
Materials and methods
The process of making of corn leaf biscuit as described by Kitessa et al., (1999) was used to
prepare biscuits of different treatments for this study. It includes chopping, grinding, mixing,
pressing and heating at temperature of 100
º
C for 5 minutes and finally cooling at room
temperature. The experimental design used was a completely randomised design with 6
treatments and 3 replications. The treatments were: R1 (100% field grass), R2 (50% field
grass + 50% corn leaf), R3 (100% corn leaf), R4 (50% field grass + 50% corn husk), R5
(50% corn leaf + 50% corn husk) and R6 (100% corn husk). The results were subjected to
ANOVA and contrast orthogonal test (Steel and Torrie, 1991). The biscuit parameters
measured were water activity, moisture, water absorption, density and nutrient quality (ash,
crude protein, crude fibre, crude fat and
nitrogen free extract).
Results and Discussion
The nutrient composition of the different grass and corn plant waste biscuits is
presented in Table 1. Results of this study indicated that the treatment of biscuit had a highly
significant effect (P <0.01) on moisture where in biscuits R1, R2 and R6 it was lower than in
biscuits R3, R4 and R5. The water absorption was significantly higher (P<0.05) for R1, R4
and R5 than biscuits R2, R3 and R6. Water activity and density were not significantly
different between biscuits (Table 2).
102
Table 1. Nutrient composition of biscuits of field grass and corn plant waste
Biscuit*
Nutrient Composition (%)
Ash
Crude
Protein
Crude
Fibre Crude Fat
Nitrogen
free extract
R1 10.42 12.89 41.33 0.21 35.14
R2 9.78 14.51 31.90 0.20 43.60
R3 8.83 16.12 29.45 1.04 44.56
R4 8.45 13.51 42.49 1.31 34.24
R5 7.94 14.41 27.25 1.66 48.73
R6 9.59 13.69 38.12 1.86 36.74
Please refer to text for composition of the different treatments
Based on this study it was shown that field grass plus corn leaf biscuits (R2) had the
best physical characteristics. Corn leaf biscuit (R3) had the best nutrient quality among the
different biscuits. It was concluded that field grass plus corn leaf could be processed to
produce biscuits as a fibre source for ruminant feed.
Table 2. Physical characteristic of biscuits of field grass and corn plant waste
Biscuit
Parameters
Water
Activity
Moisture (%)
Water absorption
(%)
Density
(g/cm
3
)
R1 0.70 ± 0.05
11.23
c
± 0.60
492.34
a
± 40.90
0.45 ± 0.03
R2 0.69 ± 0.02
11.06
c
± 0.10
383.49
c
± 31.97
0.44 ± 0.03
R3 0.69 ± 0.02
12.85
a
± 0.37
438.00
b
± 15.69
0.45 ± 0.03
R4 0.69 ± 0.02
11.73
b
± 0.17
514.48
a
± 19.95
0.48 ± 0.06
R5 0.69 ± 0.03
11.80
b
± 0.09
504.27
a
± 5.59
0.52 ± 0.03
R6 0.70 ± 0.03
11.39
c
± 0.71
452.31
b
± 42.63
0.47 ± 0.01
Means with different superscripts within the same column are significantly different at P = 0.01
References
Kitessa, S., P.C. Flinn and G.G. Irish, 1999. Comparison of methods used to predict the in
vivo digestibility of feed in ruminant. Aust. J. Agr. 50: 825
–841.
Steel, R.G.D. and J.H. Torrie, 1991. Princip
le and Statistic Procedure. McGraw-Hill Inc.
W
hiteley, P.R., 1971. Biscuit Manufacture. Applied Science Publisher, London.
103
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 13
Development of a New Quantitative Competitive PCR Assay for Rumen
Butyrate-Producing Bacterium, Butyrivibrio fibrisolvens
Taheri Ghahfarokhi, A.
*
, M. Tahmoorespur & Y. Shamshirgaran
Animal Science Department, College of Agriculture, Ferdowsi University of Mashhad,
Mashhad, Iran
*
Email of corresponding author: [email protected]
Introduction
Infusion of butyrate into the rumen of ruminants results in an increase of the concentration of
milk fat and protein. Ruminal butyrate production can be increased by increasing the numbers
of butyrate producing bacteria (Huhtanen et al., 1992). Butyrivibrio fibrisolvens strains are
presently recognised as the major butyrate-producing bacteria in the rumen. They can be
found in the digestive track of many animals and in the human gut. The aim of this study was
to develop a powerful quantitative competitive polymerase chain reaction (QC-PCR) assay
based
on 16S rDNA for the enumeration of the strains belonging to Butyrivibrio fibrisolvens
in rumen fluid.
Materials and methods
Species-specific PCR primers that amplify partial 16S rDNA region (213 bp as target DNA)
were used in this study (Kobayashi et al., 2000). Two internal primers, bearing 5′ tails which
contain
two ~30 nucleotide sequences, unrelated to the target to be amplified and
compl
ementary to each other, were designed (Figure 1). To construct the homologous
competitor with 50 bp insertion, a stepwise SOE-PCR (Splicing by Overlap Extension
Polymerase Chain Reaction) in three separate amplifications using different primer pairs was
carried out (Figure 2). For future applications and as the easiest way to determine competitor
concentration, competitor fragment was cloned into a TA plasmid vector (pTZ57R/T),
purified and quantified before use. The competitor was serially diluted and co-amplified by
PCR with total extracted DNA from rumen fluid samples.
104
Figure 1. Design and sequence of internal primers (IP1 and IP2).
QC-PCR products were electrophoresed on agarose gel containing ethidium bromide, and
photographed. Band intensities were measured using image analysis software (image J 1.42q)
to determine if co-amplification had occurred with equal efficiency. The quantity of
competitor against the ratio of amplified target to amplified competitor was plotted using log
scale and evaluated by simple regression using the JMP
®
software (SAS Institute) and finally
the R
2
was estimated as a criterion of competitive PCR performance.
Figure 2. Splicing by overlap extension polymerase chain reaction (SOE-PCR)
and used for constructing the homologous competitor fragment.
Results and Discussion
Butyrivibrio fibrisolvens species-specific primers successfully amplified a 213 bp amplicon.
The log plot of the amount of amplified target DNA against the amount of amplified
competitor DNA was highly linear (R
2
= 0.985) indicating that the homologous competitor
can potentially represent the number of target fragments. As a result of our study a new
quantitative competitive PCR (QCPCR) assay was developed for quantification and
enumeration of Butyrivibrio fibrisolvens in rumen fluid samples. The developed QCPCR
105
method can be used for monitoring changes in the population of Butyrivibrio fibrisolvens in
rumen fluid samples during nutritional treatments.
References
Huhtanen P., H. Miettinen and M. Ylinen, 1992. Effect of increasing ruminal butyrate on
milk yield and blood constituents in dairy cows fed a grass silage-based diet. J. Dairy Sci. 76
4
: 1114–1124.
Koba
yashi Y., R.J. Forster and R.M. Teather, 2000. Development of a competitive
polymerase chain reaction assay for the ruminal bacterium Butyrivibrio fibrisolvens OB156
and its use for tracking an OB156 derived recombinant. FEMS Microbiol. Lett.188
: 185–190.
106
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Lead Paper 2
Repro
ductive, Production and Economic Performances of the Damascus
(Shami) Goats in Cyprus
Abdullah, R.
1*
, M.S. Salleh
2
, W.E. Wan Khadijah
1
& A.P. Mavrogenis
3
1
Institute of Biology Sciences, Faculty of Science, University of Malaya, 50603 Kuala
Lumpur, Malaysia,
2
Asreda Corporation Sdn. Bhd., Jalan Gelugur 4/7G, Shah Alam 40000
Selangor,
3
Agricultural Research Institute, P.O. Box 22016, 1516 Nicosia, Cyprus
*
Email of corresponding author: [email protected]
Introduction
Damascus (Shami) goat is a large breed, measuring 78 cm at withers, having a body
circumference of 97 to 99 cm and adult live weight of 65 ± 5 kg (female) and 75 ± 5 kg
(male). The Damascus goat requires an improved management and feeding environment to
express its full genetic potential (Mavrogeenis et al., 1984). The goat can be managed in
small tethered or large size flocks (200 to 1000), if provided with housing, feeding and other
necessary facilities. The breed combines high prolificacy with high milk production and
growth rate (Constantinou, 1989). The main breeding season starts in late August and extends
through mid December. Occasionally a heat wave occurs in late spring or early summer, but
it is characterized by irregular oestrous cycles. This paper describes the reproductive,
production and economic performances of Shami goats.
Materials and methods
This study involved collection of data in Cyprus for both reproductive and production
parameters as well as economic performance of Shami goats (Mavrogenis and
Papachristoforou, 1990; 2000). The reproductive characteristics included percent fertility,
prolificacy, conception rate, mortality at birth and mortality at weaning. The production
characteristics included live weight and growth rate (birth weight, weaning weight, pre-
weaning growth, 15 week weight and post-weaning growth), carcass traits (carcass weight
and percent dressing) and milk performance (total yield, lactation length, amount of milk
suckled, fat content, protein content and total solids). Comparison of economic performance
between Shami and other goat breeds (Boer, Jamnapari and Saanen) was made.
Results and Discussion
Reproductive characteristics
First oestrus occurred between 220 and 270 days of age at live weights from 42 to 54 kg,
depending on type of birth. This characteristic allows for the early breeding of kids and the
initiation of the productive life at the age of 13 to 16 months. Fertility was medium to high
(80 to 90%), a characteristic of most goat breeds with high milk production. The prolificacy
of the breed was among the highest in the region, averaging 1.80 kids per goat kidding.
107
Production characteristics
Birth weights were high ranging from 3.5 to 5.5 kg, depending on type of birth and sex.
Weaning was practiced between 42 and 49 days post-partum. Kids during the suckling period
had free access to a starter diet containing 18% crude protein (CP) and good quality hay (0.2
kg of Lucerne hay). Following weaning they were group-fed on concentrate diets containing
16 to 18% CP and Lucerne or Barley hay offered ad libitum. Males grew faster than females,
and singles were faster in growth than twins or other multiples, both before and after
weaning. Kid carcasses were lean with 47.3 to 49.5 dressing percentages, depending on age at
slaughter.
The Shami goat is a dual-purpose animal (meat and milk). It is milked principally
following weaning, but also during the suckling period, because a large quantity of milk
remains in the udder without being utilized by the suckling kids. Total milk production,
including milk produced until weaning, ranged between 450 and 850 kg per goat per
lactation. Lactation lasted for approximately 7 months following weaning, although lactations
up to a year were not rare. The fat and protein contents of the milk were characteristic for
high yielding breeds, ranging from 3.8 to 4.5% for fat and from 4.0 to 4.8% for protein. The
milking goat responded positively to high protein diets by increased milk output and longer
maintenance of milk production at a high level.
Economic performance
Shami goats gave a higher income and faster return on investment (ROI) compared to other
breeds such as Boer, Jamnapari and Saanen. A two-year comparison showed Shami goats
gross profit was the highest (RM 32,660) compared with Boer (RM 7,320), Jamnapari (RM
6
,400) and Saanen (RM 13,800) goats. RIO values among the four breeds, was 7.25 for
S
hami, 4.6 for Saanen, 2.44 for Boer, and 2.13 times for Jamnapari goats.
Co
nclusions
In conclusion, Shami goats possess high reproductive as well as production characteristics.
With high milk production, Shami is an excellent breed of dairy goat and gives better and
faster economic returns on investment compared to other breeds such as Boer, Jamnapari and
Saanen. Therefore, it is apparent that Shami is a good candidate among the potential dairy
goat breeds under consideration for strategic planning of the Malaysian goat industry..
Reference
s
Mavrogenis, A.P., A. Constantinou and A. Louca, 1984. Environment and genetic causes of
variation in production traits of Damascus goats. Anim. Prod.
38: 99–104.
Constantinou, A., 1989. Genetic and environmental relationships of body weight, milk yield
and litter size in Damascus goats. Small Ruminant Res.
2: 163–174.
Mavrogenis, A.P. and C. Papachristoforou, 1990. Use of part lactation records for selection
in Chios sheep and Damascus goats. Agr. Res. Inst. Tech. Bull.
No. 122, pp. 8.
Mavrogenis, A.P. and C. Papachristoforou, 2000. Genetic and phenotypic relationships
between milk production and body weight in Chios sheep and Damascus goats. Livestock
Prod. Sci. 67
: 81–87.
108
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 14
Genotypic Characterisation of Ardi Goats in Saudi Arabia
Aljumaah, R.S.
1,2*
, M.M. Musthafa
1,2
& M.A.
Al-Shaikh
1
1
Department of Animal Production,
2
Centre of Excellence in Biotechnology Research, King
Saud University, P.O. Box 2460, Riyadh 11451, Kingdom of Saudi Arabia.
*
Email of corresponding author: [email protected]
Introduction
Adaptation of indigenous goat populations in the Kingdom of Saudi Arabia (SA) for low feed
intake, harsh environmental conditions and limited water resources was reported by El-Nouty
et al. (1990). The common native goat breeds in the Kingdom are Ardi, Bishi, Jabaly and
Tohami. Ardi goat is black coloured with white leaf ears and horns present in both sexes (Fig.
1).
Genetic characterisation is very useful and widely used to categorise animals in the world
and important for conservation of genetic resources (Kevorkian et al., 2010). Thus,
characterisation could enhance many attributes of breed traits such as resistance to diseases
and fertility. Microsatellites are the markers of choice for genetic characterisation of livestock
due to their various advantages (Baumung et al., 2004). The objective of the present study
was to evaluate the genetic variability of Ardi goats in SA based on microsatellites.
Figure 1. Male (a) and female (b) goats of Ardi breed.
Ma
terials and methods
Unrelated and randomly selected 43 Ardi goats were blood sampled (10 mL from the jugular
vein)
and the DNA was extracted using GFX Genomic Blood Kit and checked for quality and
quantity using a spectrophotometer. Fourteen fluorescent labelled microsatellite markers,
recommended by International Society for Animal Genetics (ISAG) were used to extract and
amplify the DNA by PCR using an AB GeneAmp® PCR 9700. Amplified products were
separated by ABI Genetic Analyser 3130. Microsatellite fragment sizing was performed by
the GeneMapper® v.4.0. Statistical analysis was carried out using Cervus v.3.0.3 from Field
Genetics Limited to assess the expected heterozygosity (He), observed heterozygosity (Ho)
and polymorphic information content (PIC). Fixation Index (Fis) and Hardy Weinberg
Equilibrium (HWE) were calculated by GenePop v.4.0.10., and Bottleneck was analysed
using v.1.2.02. Popgene v.1.31.
a b
109
Results and Discussion
All 14 microsatellites tested amplified well and were found to be polymorphic, containing a
minimum of three alleles and a maximum of nine alleles. The highest observed
heterozygosity was shown by locus SPS113 (0.88), while the lowest was (0.26) by MAF209.
Maximum He was given by MAF70
(0.83) and the minimum was (0.35) by ILSTS005. Ten
markers (Table 1) showed higher heterozygote alleles than the homozygote. All of the
markers showed alleles which were within the expected sizes. HWE test indicated that seven
loci
: ILSTS011, ILSTS005, SPS113, ILSTS029, SRCRSP3, M AF70 and OarAE54, were in
HWE. All markers, except ILSTS005,
showed acceptable informative capacity with PIC
values higher than 0.5. Mean Fis value was 0.18. Ardi showed higher expected genetic
diversity (0.69) when compared with some Asian goat breeds of southern Sri Lanka (0.48),
Jamunapari (0.54) (Gour et al., 2006), and Korean goats (0.38) (Kim et al., 2002). On the
other hand Ardi showed less genetic diversity when compared with some of the Indian
breeds: Kutchi (0.80), and Mehsana (0.77) (Behl et al., 2003). The mean number of alleles and
He detected were very good indices of the genetic polymorphism within breeds. The PIC
values show the suitability of the markers for analysing the genetic variability. Kumar et al.
(2009) reported the PIC mean of 0.65 for Gohilwaris. The high PIC values of the particular
markers suggest their usefulness for genetic polymorphism related research and linkage
mapping projects in goats. Mode shift indicator and Sign test, Standardised Differences test
and Wilcoxon rank test showed that there was no bottleneck in Ardi goats. In general, from
all of these indices, Ardi goats have a considerable amount of genetic polymorphism.
Therefore, any unique alleles present in this breed may not have been lost.
Table 1. Genetic variability parameters of Ardi goats
Marker na ne Ho He PIC Fis HWE
ILSTS011 8 2.42 0.58 0.58 0.54 0.008 NS
OarFCB20 9 2.44 0.48 0.59 0.55 0.175 *
SPS113 7 4.08 0.87 0.75 0.70 -0.161 NS
ILSTS029 7 4.40 0.69 0.75 0.71 0.049 **
MAF209 3 1.99 0.25 0.49 0.43 0.490 NS
OarFCB48 8 4.31 0.39 0.76 0.72 0.488 **
SRCRSP3 3 2.37 0.61 0.57 0.50 -0.056 NS
ETH10 7 4.31 0.50 0.76 0.71 -0.056 **
MAF70 8 5.92 0.86 0.83 0.79 -0.044 NS
ILSTS005 5 1.54 0.26 0.35 0.33 0.025 NS
OarAE54 9 3.14 0.65 0.68 0.64 0.035 NS
BM6444 4 3.19 0.57 0.68 0.60 0.163 **
INRA023 8 5.47 0.63 0.81 0.78 0.226 **
TGLA53 7 4.39 0.34 0.77 0.73 0.000 **
110
References
Baumung, R., H. Simianer and I. Hoffmann, 2004. Genetic diversity studies in farm animals
–
a survey. J. Anim. Breed. Genet. 121 : 361–373.
Behl, R., N. Sheoran, J. Behl, R.K. Vijh and M.S. Tantia, 2003. Analysis of 22 heterologous
microsatellite markers for genetic variability in Indian goats. Anim. Biotech.
14: 167–175.
El-Nouty, F.D., A.A. Al-Haideray and S.M. Basmaeil, 1990. Physiological responses, feed
inta
ke, urine volume and serum osmolality of Ardi goats deprived of water during spring and
summer. Aust.
J. Anim. Sci. 3: 331–336.
Gour, D.S., G. Malik, S.P.S. Ahlawat, A.K. Pandey, G.R.N. Sharma, S.C. Gupta, P.S. Bisen
and
D. Kumar, 2006. Analysis of genetic structure of Jamunapari goats by microsatellite
markers. Small Rum. Res.
66: 140–149.
Kevorkian, S.E.M., S.E. Georgescu, M.A. Manea, M. Zaulet, A.O. Hermenean and M.
Costache, 2010. Genetic diversity using microsatellite markers in four Romanian
autochthonus sheep breeds. Rom. Biotech. Lett.
15 (1): 5059–5065.
Kim, K.S., J.S. Yeo, J.W. Lee, J.W. Kim and C.B. Choi, 2002. Genetic diversity of goats
from Korea and China using microsatellite analysis. Asian–
Aust. J. Anim. Sci. 15: 461–465.
Kumar, S., S.P. Dixit, N.K. Verma, D.K. Singh, A.
S. Kumar, R. Chander and L.B.
Singh, 2009. Genetic diversity analysis of the Gohilwari breed of Indian goat (Capra hircus)
using microsatellite markers. Am. J. Anim. Vet. Sci. 4
(3): 49–57.
111
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 15
Effect of Estrus Synchronisation with Sponge and CIDR on Pregnancy
Rate, Sex and Birth Type of Kids in Iranian Adani (Persian Gulf) Goats
Bidari, M.
1*
, M. Dashtizadeh
2,3
, M.S. Yazdanshenas
1
, A. Ghotbi
1
& H. Avazi Yadkuri
1
1
Bushehr Province Agricultural Jehad Organisation,
2
Institute of Applied Scientific
Education of Jehad e Agriculture,
3
The Centre for Research in Agriculture and Natural
Resources, Bushehr, Iran
*
Email of corresponding author: [email protected]
Introduction
Adani goat is a well-adapted dairy breed, which is raised in coastal areas of the Persian Gulf
in the Bushehr province in southern Iran. In these areas, the climate is harsh with high
temperatures and humidity and poor quality pastures. This breed of goat is well-adapted to
these conditions and shortage of forage. Adani goat is maintained as household animal and
has suitable litter size and high pregnancy rate. The average twinning rate is 0.7 and generally
it has three pregnancies in two years. In goats, control of estrus and ovulation is a valuable
tool to improve and maintain milk and meat production throughout the year. Therefore, estrus
synchronisation together with artificial insemination (AI) is extensively applied in the
reproductive management of goats (Leboeuf et al., 1998). Estrus synchronisation in livestock
focuses on the manipulation of either the luteal or the follicular phase of the estrous cycle
(Wildeus, 1999). During the breeding season, when goats are actively cycling, estrus can be
synchronised with PGF2α or one of its analogues, such as cloprostenol (Bitaraf et al., 2007).
The most widely used procedures for synchronisation and/or the induction of estrus are 12–
21 da
ys of intravaginal sponge treatments (Fonseca et al., 2005; Kausar et al., 2009). No
study has been done on synchronisation and reproduction traits of Adani goats. The aim of
this study was to investigate the effect of estrus synchronisation with CIDR and sponge on
the pregnancy rate, gender and birth type of kids in Adani goats.
Materials and methods
A total of 333 dairy female Adani goats (aged 2.5 to 5 years) in seasonal breeding, were
allotted to ten groups and synchronised by CIDR (EAZI-BREED, New Zealand) containing
0.3 g of progesterone (n = 127 and number of groups = 5) and sponges (EAZI-BREED, New
Zealand) containing 45 mg of norgestomet (n = 206 and number of groups = 5). After 14
days the CIDR and sponge were removed and the animal injected with 2 mL PMSG and 2
mL pregnecol for the CIDR and sponge groups, respectively. After 36 hours male goats were
added to the groups for 48 hours. One male goat was used to mate 6 to 7 does. The pregnancy
rate was computed for each group and birth type and sex of kids recorded. The effect of
CIDR and sponge on pregnancy rate was compared by t-test and the effect of CIDR and
sponge on gender and birth type of kids was compared by Chi-Square test (via contingency
tables).
SAS ver. 9.1 Software was used for both analyses.
112
Results and Discussion
The effect of CIDR and sponge on pregnancy rate, gender and birth type of kids in Adani
goats are shown in Tables 1 and 2. No significant difference was seen between sponge and
CIDR (t = 0.03 and P>0.05) on pregnancy rate. Based on Chi-Square test, Sponge and CIDR
had no significant effect on gender ( 0.49 and P>0.05)
and birth type ( 5.98 and
P>0.05)
of kids. It can be concluded that either sponge or CIDR procedures can be used to
synchronise estrus with a pregnancy rate of 49% in Adani does.
Table 1. The effect of sponge and CIDR on pregnancy
rate in Adani goats (in percentage)
Treatment n Mean t-value P
Sponge 5 49.5
a
0.03 0.9770
CIDR 5 49.2
a
a
Means within column with different superscripts differ at P<0.05
Table2. The effect of sponge and CIDR on sex and birth type of
kids (in percentage)
Treatment
Sex Birth type
Male Female Total 1 2 3 Total
Sponge 63 68 131 66 31 1 98
CIDR 44 39 83 34 17 5 56
Total 107 107 214 100 48 6 154
References
Bitaraf, A., M.J. Zamiri, M. Kafi and J. Izadifard, 2007. Efficacy of CIDR, fluogestone
acetate sponges and cloprostenol for estrous synchronisation of Nadooshani goats during the
breeding season. Iranian J Vet. Res. 8
: 218–224.
Fonseca, J.F., Bruschi, J.H. Zambrini, F.N.E. Demczuk, J.H.M. Viana and M.P. Palhao,
2005
. Induction of synchronised estrus in dairy goats with different gonadotrophins. Anim.
Reprod.
2: 50–53.
Kausar, R., S.A. Khanum, M. Hussain and M.S. Shah, 2009. Estrus synchronisation with
medroxyprogesterone acetate impregnated sponges in goats (Capra hircus). Pakistan Vet. J.,
29
(1): 16–18.
Leboeuf, B., E. Manfredi, P. Boue, A. Piacere, G. Brice, G. Baril, C. Broqua, P. Humblot and
M. Te
rqui, 1998. Artificial insemination of dairy goats in France. Livest. Prod. Sci. 55: 193
–
203.
Wildeus, S. 1999. Current concepts in synchronisation of estrus: Sheep and goats.
Proceedings of the American Society of Animal Science. Pp.
2
2
113
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 16
Estimation of Genetic Parameters for Growth Traits of Iranian Adani
(Persian Gulf) Goats
Dashtizadeh, M.
1,2*
, M. S. Yazdanshenas
3
, A. Ghotbi
3
& H. Haghparast
3
1
Institute of Applied Scientific Education of Jehad e Agriculture, Bushehr, Iran,
2
The Centre for Research in Agriculture and Natural Resources, Bushehr, Iran,
3
Bushehr Province Agricultural Jehad Organization, Bushehr, Iran
*
Email of corresponding author: [email protected]
Introduction
Adani dairy goat is one of the most important breeds in southern Iran. This breed is reared in
the coastal areas of the Persian Gulf in Bushehr province. In these areas, the climate is harsh
due to high temperature and humidity and lack of good pasture. Adani goats are maintained
as household animals under intensive systems. This breed adapts well to the harsh conditions
of, and shortage of forage in, the coastal areas. It is a good breed for the export market. The
goats are very quiet in behavior.
Growth is one of the important traits in animal production. Weight gain in animals is
determined not only by their own genetics but by other factors as well (Zhang et al., 2008).
Therefore, it would be important to determine the additive genetic, maternal and
environmental effects of animals for production. Birth traits are often considered as an early
indicator of growth and production because they correlate highly between them (Portolano et
al., 2002). In fact several studies have estimated genetic parameters for growth traits in Asian
goats (Zhang et al., 2008; Hermiz et al., 2009; Weng-Zhong et al., 2010). Gholizadeh et al.
(2010) estimated genetic parameters for birth and weaning weights in Iranian Raeini goats.
However, no such study has been done on Adani goats. The aim of this study was to estimate
the genetic and phenotypic parameters for growth traits of Iranian Adani goats using a
multiple-traits model.
Materials and Methods
Data consisting of growth traits of Iranian Adani goats born between 2006 and 2012 were
obtained from the Adani Goat Breeding Centre of the Bushehr province. The growth traits
obtained were birth weight (BW), weaning weight (WW), 3-month weight (W3), 6-month
weight (W6), 9-month weight (W9) and 12-month weight (W12). The data consisted of 5934
growth records for 1349 goats and progeny of 79 sires and 366 dams. Heritability, maternal
effect and genetic and phenotypic correlations between growth records were estimated using
the multiple-traits model. The following model was used for growth records:
wher
e, = Body weight, = random effect for animal, = random maternal effect, =
fi
xed effect of contemporary groups, = fixed effect of birth type, = fixed effect of sex,
2
1
2
2
1 n
ijlklmn
n
ijklmnn
n
ijklmn
n
mlkjiijkl eAGEbamageDMaSTCy ijkl
y l
a m
M i
C j
T k
S
114
= fixed covariate of dam age, = fixed covariate of age at recording time and =
res
idual error.
Variance components were estimated by the restricted maximum likelihood (REML) method
using the wombat software.
.
Figure 1. Iranian Adani goats
Results and Discussion
The heritability estimates, genetic and phenotypic correlations for body weight are presented
in Table 1. Heritability estimates for body weight ranged from 0.18 to 0.55 and were highest
in second half of lactation. Maternal effect ranged from 0.04 to 0.62 and was highest for
weaning weight. Genetic correlations between body weights were highest between adjacent
weights, which decreased as the distance between them increased. Phenotypic correlations
followed a similar pattern but were lower than the corresponding genetic correlations.
Table 1. Heritability (main diagonal), maternal effect (in parenthesis main
diagonal), genetic (above diagonal) and phenotypic (below diagonal) correlations
for body weights
BW WW W3 W6 W9 W12
1
BW 0.55 (0.1) 0.90 0.81 0.69 0.60 0.51
WW 0.79 0.18 (0.62) 0.90 0.80 0.70 0.61
W3 0.79 0.74 0.47 (0.09) 0.90 0.80 0.69
W6 0.68 0.71 0.9 0.43 (0.17) 0.90 0.80
W9 0.61 0.6 0.82 0.9 0.53 (0.11) 0.90
W12 0.49 0.46 0.7 0.79 0.9 0.48 (0.04)
BW, birth weight; WW, weaning weight, W3, weight at 3 month; W6, weight at 6 month, W9,
weight at 9 month; W12, weight at 12 month
References
Gholizadeh, M., G. Rahimi Mianji, M. Hashemi and H. Hafezian, 2010. Genetic parameter
estimates for birth and weaning weights in Raeini goats. Czech J. Anim. Sci.
55 (1): 30–36.
Hermiz, H.N., J.E. Alkass, A.A. Hobi and M.K. Asofi, 2009. Genetic and phenotypic
parameters of body weights in Iraqi local goats and their crosses with Damascus. The
Second Kurdistan Conference on Biological Sciences. J. Duhok Univ
. 12 (1) (Special Issue),
pp. 189–194.
Damage AGE ijlk
e
115
Portolano, B., M. Torado, M. Finocchiaro and R. Vankaam, 2002. Estimation of the genetic
and phenotypic variance of several growth traits of the Sicilian Girgentana goat. Small.
Rumin. Res. 26: 271–
289.
Weng-Zhong, L., Z. Yuan and Z. Zhong-xiao, 2010. Model selection in estimation of
covariance function for growth of Angora goats. Agri. Sci. China, 9
(7): 1041–1049.
Z
hang, H., L. Yang and Z. Shen, 2008. Variance components and genetic parameters for
weight and size at birth in Boer goats. Livest. Prod. Sci. 115: 73–
79.
116
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 17
Effects of Synchronisation and Artificial Insemination with Alpine and
Saanen Semen on Reproductive Traits of Iranian Goat Breeds
Emami Mibody, M.A.
1*
, A.A. Gasemi
2
, S.J. Hossaini
2
& R. Aliverdi Nassab
1
1
Agriculture and Natural Resource Institute Yazd, Iran
2
Agriculture Office in Yazd Province, Iran.
*
Email of corresponding author: [email protected]
Introduction
Yazd province is one of the driest areas in the central part of Iran. It receives less than 100
mm of rain annually. The Nodoshani and Rabati goats are the local breeds of the Yazd
province and the Raeini breed is of Kerman Province (Ghorbanpor Dashtaki, 1993). The
Nodoshani and Rabati breeds are dual purpose breeds (milk and cashmere wool) and Raeini
breed is the most productive cashmere goats in Iran. All of these are raised under poor range
conditions (Emami Mibody, 1990). Currently, goats of these breeds are raised in farms and
farmers still aspire to get high producing breeds which can adapt to the environment.
This study was conducted to evaluate reproductive parameters of the Nodoshani,
Rabati and Raeini breeds bred to Alpine and Saanen dairy goats to produce off springs which
were reported to have high potential for milk production and reproductive performance
(Abdul-Vahid, 1988; Carica and Bravo, 1987; Song et al., 2000).
Materials and Methods
Seventy does, each of the Nodoshani, Rabati and Raeini breeds, were selected and
synchronised in the fall by CIDER (Horst, 1997). Teaser animals were used to detect does in
heat followed by artificial insemination with Saanen and Alpine frozen semen (Whitley and
Jackson, 2004.).
Heat detection rates, parturition records including sex, birth weight of kids and types
of birth, were recorded and analysed by GLM procedure of the Statistical Analysis System
(SAS, 1997; Song et al., 2000).
Results and Discussion
On average 94% of animals showed heat signs, with Nodoshani, Rabati and Raeini does
showing 94, 97 and 91%, respectively. The average apparent pregnancy rate (parturition)
was 36%: 40, 44 and 29% for Nodoshani, Rabati and Raeini does, respectively. The number
of kids per parturition was 1.77 ± 0.65, 1.43 ± 0.57 and 1.58 ± 0.69 for Nodoshani, Rabati
and Raeini does, respectively, with an average of 1.59
±0.64 kids for all breeds. The average
total weight of kids in each parturition was 3.36 1.3 kg for all breeds; the corresponding
values being 3.93 ± 1.44, 4.05 ± 0.08 and 3.07 ± 0.87 kg for Raeini, Nodoshani and Rabati breeds, respectively. This study showed that the number of kids and their weight per
parturition were highest in the Nodoshani breed.
117
The average gestation period was 149.74 ± 3.63 days for all breeds and 150.21 ± 2.57,
148.88 ± 1.9 and 148.93 ± 2.03 days for Raeini, Nodoshani and Rabati breeds, respectively.
Raeini breed had a longer (P<0.05) gestation period than the other two breeds.
References
Emami Mibody, M.A., 1990. Estimation of genetic parameters of economic traits of Raeini
goats. M.S. thesis, Ferdosi University, Iran.
Ghorbanpor Dashtaki, M.M., 1993. The effect of flushing and PMSG on reproductive traits
of
Nodoshani goat. M.S. thesis. Gillan University, Iran.
Abdul-Vahid, R. and P. Hamzah-chah, 1988. Introduction of Saanen and Anglo Nubian Local
and Jamnapari. Local crossbred goats conservation on their growth performance. CAB.
Animal Breeding
Abstract.
Carica, B.E. and P.J. Bravo, 1987. Genetic improvement of Crioli goats in Venezuela by
means of crossbreeding with improved breeds 1: Growth of kids. CAB Animal Breeding
Abstract.
Horst, P., 1997. Animal breeding as a factor of influence on the conservation of natural
resources and utilisation of genetic resources. Anim. Res. Develop. 46: 63–75.
SAS Institute Inc. 1997. Cary, North Carolina. USA.
Song, H.B., I.K. Choi and T.G. Mio, 2000. Reproductive traits in the Korean native goats.
College of Natural Resources, Taegu University.
Whitley, N.C. and D.J. Jackson, 2004. An update on estrus synchronisation in goats: A minor
species. J. Anim. Sci.
82 (E. Suppl.): E270–E276.
118
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12
April 2012
Paper 18
Milk Production of Local Qomi and F1 and F2 Qomi × Saanen Goats in
Iran
Hoseini, S M.
1*
, A. Ghazikhani
1
, M. Kalantar
2
& H. Yazdi
1
1
Department of Animal Science, Saveh Branch. Islamic Azad University, Saveh, Iran
2
Agricultural Research Centre of Qom, Qom, Iran.
*
Email of corresponding author: [email protected]
Introduction
In Iran goats are kept primarily for meat production and they are not a significant source of
milk. There is a great potential for development of milk production from goats in Iran and the
projects for this purpose have already been initiated in recent years. Crossbreeding is a
logical step to improve meat and milk production of local goats and has been practiced in
many countries. Crossbreeding has been used for a number of reasons including the benefit of
heterosis, as an initial stage of transition in establishing a breed (grading up) or for the
development of a new breed (Donkin, 1997). The option of crossbreeding to introduce
suitable genetic material for milk production is a much more rapid method than that of
attempting to improve milk yield of local goat breeds by selection (Karua, 1989). The
research project was concerned with evaluation of milk production from local and crossbred
goats. This study is continuation of an earlier study (Hoseini et al., 2011) and is aimed at
determining the milk production of local Qomi and Qomi × Saanen goats.
Materials and Methods
Milk production records at second, third, fourth and fifth month of lactation of local Qomi, F1
and F2 Qomi × Saanen crossbred goats were used in this study. Data were analysed using the
GLM procedure in SAS. Estrus synchronisation and artificial insemination technology were
used in the breeding of local Qomi and Qomi × Saanen F1
and F2 goats.
Results and Discussion
The mean daily milk yield was 0.48, 1.1 and 1.4 kg for local Qomi, F1 and F2 Qomi × Saanen
goats, respectively. There were significant differences in mean daily milk yield between local
and crossbred goats. Mean milk yields from second to fifth month of lactation of local Qomi,
F1 and F2 Qomi × Saanen goats were significantly different (P<0.05) (Table 1). The results of
this study are similar to those of previous researchers (Donkin, 1997; Dinh, 1998; Juan et al.,
2001) who also showed significant difference between local with crossbred goats. This study
showed that the milk production of F2 Qomi × Saanen was higher than that of the Qomi local
and the F1
crossbreds.
119
Table 1: Mean daily milk yield of local Qomi and F1 and F2 Qomi x Saanen
goats during lactation
Month of
lactation
Milk yield (kg)
F2 Qomi x Saanen F1 Qomi x Saanen Local Qomi
2 1.85 ± 0.02
c
1.44 ± 0.12
b
0.64 ± 0.05
a
3 1.45 ± 0.23
b
1.13 ± 0.11
b
0.53 ± 0.03
a
4 1.21 ± 0.09
b
1.08 ± 0.08
b
0.39 ± 0.03
a
5 1.11 ± 0.53
c
0.77 ± 0.05
b
0.36 ± 0.03
a
a,b,c
Means within row with different superscripts differ at P<0.05
References
Karua, S.K. and J.W. Banda, 1989. The performance of the small East African goats and their
Saanen crosses in Malawi. MSc Thesis. University of Malawi, 130 pp.
Juan, M. 2001. Use of high yielding goat breed for milk production. Livestock Prod. Sci. 71:
59
–73.
Dinh, V.B., T.V. Do and T.B. Pham, 998. Study to find out the performance of F1 between
Indian and local Co in Vietnamese raising condition. Proceeding of Workshop of Animal
Production Science. pp. 112–121.
Donkin,
E.F. 1997. Productivity and disease of Saanen, Indigenous and Crossbred goats on
zero grazing. Ph.D. Thesis. Medical University of Southern Africa.
Hoseini, S.M., A. Ghazikhani and M. Kalantar, 2011. Comparison the genetic potential of
some growth and milk traits of hybrid (crossed) Saanen with Native Goat (Lori Black Goat)
versus Native goats in Qom Province. SAADC 2011 Congress, Thailand, pp. 388.
120
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 19
Serum Protein Polymorphism in Iraqi Local Goats Using Polyacrylamide
Gel Electrophoresis: Transferrin (β-Globulin) Polymorphism
Jaayid, T.A.
Animal Production Department,
College of Agriculture, Basrah University, Iraq
Email of corresponding author: [email protected]
The present study was conducted to determine the presence of polymorphism at transferrin
(Tf) locus in local Iraqi goats using a polyacrylamide gel electrophoresis (PAGE) following
the method developed by Khaertdinov and Gataulin (2000). This study was carried out at the
Animal Farm, Hartha Research Station, College of Agriculture, Basrah University and in
several farms in Basrah Province, Iraq. Gene frequencies were calculated by gene counting,
because the mode of inheritance of each of the systems that does show variation is by co-
dominant alleles at an autosomal locus. The allele frequencies in Tf locus were estimated by
direct counting of the genotypes. To test differences between observed and expected
genotype frequencies, a chi-square (
2
) analysis was performed on the basis of the Hardy-
Weinberg law.
Figure 1 shows the electrophoretical pattern of goat (Capra hircus) protein samples
and the corresponding isolated Tf. PAGE at pH 8.6 gave a good separation of the four main
goats serum blood fractions, i.e. prealbumin; albumin; Tf and γ-albumin. Two bands were
detected when transferrin was stained with Amido Black. The goat transferrin types were
named according to the nomenclature suggested by Irnazarow and Bialowas (1994) and
Jurecka et al. (2009).
Figure 1. Transferrin genotypes detected by polyacrylamide gel disc
electrophoresis patterns at pH 8.6 in local Iraqi goats
The results showed variation in the samples of goats (Table 1). The presence of transferrin
genetic polymorphism with more than one allele was demonstrated. There were many
ge
notypes (AA, BB, AB, AC and BC), in order of decreasing mobility in goats sera, from the
1 2 3 4 5 6 7
121
alleles (A, B and C) that could be inherited according to Mendelian laws. The genetic
variants differed by only a few amino acid substitutions. The A allele was more predominant
than B and C alleles (0.55, 0.36 and 0.10, respectively). The majority of Tf genotypes
represented only AA and BB variants. These had affected all five genotypes. Homozygous
genotypes AA and BB (45 and 27%, respectively) were predominant followed by the
heterozygous genotypes AC (11%) and BC (9%). The CC genotype was not seen.
Differences between expected number and observed number for transferrin genotypes were
not significant on the basis of the Hardy-Weinberg law. Hence, the transferrin polymorphism
is genetic and the goat population is genetically balanced for the Tf locus. This study showed
that there is lack of selection or genetic improvement programme in these animals.
Table 1. Distribution of transferrin genotype frequency and gene frequency for
transferrin locus in local Iraqi goats
Transferrin genotypes (n = 100)
2
Gene frequency
AA BB AB AC BC A B C
Number 45 27 8 11 9 2.28 0.55 0.36 0.10
% 45 27 8 11 9
To our knowledge, this is the first large-scale analysis on the genetic polymorphism of
transferrin alleles in the local Iraqi goats (Capra hircus). The alleles discovered could
possibly be used for the benefit of the genetic improvement programmes of domestic animals
and conservation of bio-diversity.
References
Irnazarow, I. and S.H. Bialowas, 1994. Genetic characteristics of carp breeding lines at the
Institute of Ichthyobiology and Aquaculture of the Polish Academy of Science Golysz. 1.
Polish lines. Acta Hydroiol. 36: 125–
142.
Jurecka, P., F. Geert, B. Wiegertjes, L. Krzystof, A. Rakus, A. Andrzej and I.A. Ilgiz, 2009.
Genetic resistance of carp (Cayprinus carpio L.) to Trypanosome borreli: Influence of
transferrin polymorphisms. Vet. Immunol. Immunopathol. 127: 19–
25.
Khaertdinov, R.A. and A.M. Gataulin, 2000. The selection to increase protein and
improvement of technological properties of milk
– Kazan, Russia, pp.164.
122
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 20
Phenotypic and Genetic Marker of Dairy Goat Performances Based on the
Polymorphism of Acaca Gene
Maylinda, S.
*
& T.E. Susilorini
Faculty of Animal Husbandry, Brawijaya University, Indonesia
*
Email of corresponding author: [email protected]
Introduction
Etawa Crossbred goat or Peranakan Etawah (PE) is a popular dairy goat breed in Indonesia.
In East Java, although the population of goats has increased from 2,384,973 in 2005 to
2
,780,822 in 2009 (DGAHV, 2010), the performance of the Etawah Crossbred goat is still
unknown. For this goat breed many aspects such as breeding, feeding, management and
disease control need to be improved. Obviously superior animals can be obtained through
good breeding programmes. These programmes could utilize Marker Assisted Selection
(MAS) method based on the genotypic/genetic marker for a particular trait. The use of
marker-based selection is very powerful because it can increase efficiency of selection
according to the requirement. The aim of the study was to develop a method for breeding of
Etawah crossbred goats through potential qualitative characteristic identification as a
phenotypic marker for milk quality and a potential technology to determine the genetic
marker in PE goat selection.
Materials and Methods
The research was conducted at Malang, East Java. Thirty-three female Etawa goats in their
first to third lactation were used in the study. The parameters determined in the study were
quantitative traits such as milk production, milk quality, body condition score (BCS) and
qualitative traits such as head colour, ear type, and body colour. The research was conducted
in two stages: field and laboratory studies.
Field study: This study involved phenotypic data collection, such as milk sample, BCS, head
color, ear type, and blood sampling.
Laboratory study: This study involved milk quality and DNA analyses. DNA analysis was
done by DNA and PCR and RFLP analyses. The PCR was done using primers F (5‟–
AGTGTAGAAGGGACAGCCCAGC–3‟ ) and R (5‟
–GTGGAATGACACATGGAGAGGG
–
3‟) to amplify 200 bp of ACACA gene in intron 3‟. RFLP was done using Rsa1 restriction
enzyme to examine base mutation. After digestion with Rsa1, the products were subjected to
2% agarose gel electrophoresis.
Based on the band pattern of the agarose gel, two alleles, G and T, were evident. By
using the PICi = 1 - ∑ p
2
ij the resulting degree of polymorphism in ACACA locus was shown
to be 43%. The relationship between qualitative and quantitative data was determined using
ANOVA model One Way Layout unbalanced
design using Genstat Release 7.22 TE 2008.
123
Results and Discussion
The results showed that the qualitative characters of ear type and head colour had no effect on
milk fat and protein content. However the chest girth (CG), body length (BL), body height
(BH) and BCS correlated well with the qualitative character such as body and head colour.
Head width correlated with CG and BH, and head length with CG, BL and BH. Ear width
correlated with CG and BL and ear length with BL. The BCS had significantly affected BL,
while head colour significantly affected CG, BH and BL (P<0.01). The greatest influence on
BH was on brown head followed by white, black and black-white with measurements of 76.0,
75.64, 72.72 and 67.57 cm, respectively.
Based on the agarose gel electrophoresis (Figure 1), the genetic polymorphism of
ACACA gene in goat population was 43%, while the frequencies of G and T alleles were 31
and 69%, respectively. The genotypes that existed in the population were GT and TT. There
is no significant effect of genotype on milk fat and protein content.
Figure 1.
Agarose gel electrophoresis of PCR-RFLP products.
M = marker; GT, TT = phenotypes
Conclusions
The BCS is related with animal condition and describes the genetic potential and
management implemented on the animals. It is concluded that qualitative traits have no effect
on milk yield and milk quality, but have significant effect on the linear measurements of goat.
Although only two genotypes of ACACA locus existed in the population, genetic
polymorphism was high. The ACACA genotypes in the population could not be used as
genetic marker for milk yield and milk production.
References
DGAHV, 2010. Directorate General of Animal Husbandry and Veterinary, Ministry of
Agriculture of the Republic of Indonesia.
M TT GT GG GT GG GT GT GT GT GT GT GT GT TT
124
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 21
Effect of Body Condition Score on Milk Yield, Protein and Fat Contents in
Etawah Crossbred Dairy Goats
Susilorini, T.E.
*
, Suyadi, S. Maylinda & P. Surjowardojo
Unive
rsity of Brawijaya, Faculty of Animal Husbandry. Jl. Veteran,
Malang 65145 Indonesia
*
Email of corresponding author: [email protected]
Introduction
Etawah crossbred, one of dairy goat types in Indonesia, is distributed in almost all regions.
This breed is a dual purpose goat – used both for meat and milk production. This goat is
beli
eved to be the result of undirected natural crosses between Etawah goats originating from
India and the local goats, Kambing Kacang, with unpredicted genetic composition. At
present, this goat contributes most to the population of goats in Indonesia and is more
recognized as Etawah Crossbred (Ind: Peranakan Etawa, PE-goat).
In station, mature Etawah crossbred doe produces between 0.5 to 2.0 L milk/day
(Sutama, 2011), indicating that this breed has high potential for selection and development as
milk goat type. According to FAO (2011) Etawah goat in temperate region produced daily
milk on the average of 1.725 ± 0.031 kg.
It is well-known that nutrition, live weight and body condition score (BCS) are
important factors, which influence the phenotype and milk production of farm animals
(Meyers-Raybon, 2010). Change in BCS should be used to assess the level and change of
body fat stores and as an indicator of energy balance. The ideal BCS will support peak milk
production during the negative energy balance of lactation. Many studies showed that BCS
had a high correlation with milk production and composition (Zahraddeen et al., 2009,
Ahmed
et al., 2010
; Pambu et al., 2011) and affected the reproductive performance of dairy
goats (Suharto et al., 2008; Serin et al., 2010). The objective of present study was to evaluate
the e
ffects of BCS on yield, protein and fat contents of milk from the Etawah crossbred dairy
goats.
Materials and Methods
The study was carried out under ASPENAS (National Etawa Farmer Association) in Blitar
and Malang Regencies, East Java, Indonesia. Fifty-two Etawah crossbred goats were used in
the experiment, conducted during period of March to December 2011. The BCS
determination was carried out at lactation by the same person, according to Detweiler et al.
(2011), who scored the body conformation by palpation. Scores were assigned a five-point
scale from 1 = thin to 5 = grossly fat based on palpation of the body. Half scores were also
included. Milk yield was recorded within the first 90 days of lactation, and protein and fat
contents were determined biweekly by the Lactoscan Milk Analyzer. Milk yield was adjusted
to energy corrected milk (ECM) of 4% fat and 3.3% protein (Hemme, 2010). The goats were
125
divided into 5 groups according to the BCS values. The data were statistically analysed by
ANOVA (Genstat 12.2).
Results and Discussion
The daily milk yield increased significantly (P<0.01) with increase in BCS (Table 1). The
animal with BCS 2 produced 1185.2 ± 399.5 mL ECM. The production was higher in the
animal groups with BCS of 2.5, 3.0, 3.5 and 4.0 that recorded 1207.3 ± 366.5, 1691.9 ±
457.6, 1568.3 ± 340.1 and 1614.6 ± 396.6 mL ECM, respectively. The average milk yield in
the present study was higher than that reported by Suranindiyah et al. (2009), which was 774
± 291 mL/day for the same breed, but was lower than the Etawah pure breed goats (2.15 ±
0.30 kg/day)
Table 1. Daily milk yield, protein and fat content of Etawah Crossbred goat milk
Parameter
Body Condition Score (BCS)
2 (N = 7) 2.5 (N = 16) 3 (N = 21) 3.5 (N = 6) 4 (N = 2)
Milk Yield
(mL ECM)
1185.2
a
±
399.5
1207.3
a
±
366.5
1691.9
b
±
457.6
1568.3
ab
±
340.1
1614.6
ab
±
396.6
Protein (%)
3.03 ± 0.14 3.09 ± 0.13 3.06 ± 0.13 3.13 ± 0.09 2.84 ± 0.02
Fat (%)
6.37 ± 1.09 6.56 ± 0.98 6.85 ± 0.91 6.85 ± 1.06 6.09 ± 1.12
Values are means ± std errors
a,b
Means within row with different superscripts were significantly different at P<0.001
Protein and fat contents in milk from the Etawah crossbred were not affected by BCS of the
animals, although the does with BCS of 3.5 tended to have higher protein and fat contents in
milk than the other groups. The BCS of the animal reflects the nutrient status, internal
physiological condition and energy reserves in the body of animal. In the present study,
increase in BCS significantly (P<0.01) increased milk production but did not affect protein
and fat contents of milk.
Conclusions
Body condition score in an important indicator for predicting the potential milk production in
Etawa Crossbreed goats. Goats with higher BCS, between 2 and 4 showed significant
increase in milk production. However, BCS did not influence protein and fat content of milk.
Acknowledgements
The principal author wishes to thank the Directorate General of Higher Education, Ministry
of National Education, Indonesia for providing PhD scholarship (BPPS) for the study. We are
also extremely grateful to the farmers in ASPENAS groups for the cooperation extended
towards the successful completion of this study.
126
References
Ahmed, B.M.S., N.N. Maarof and T.Y. Petrus, 2010. Effect of body condition score on
productive performance of local Karadi cows. J. Zankoy Sulaimani, Part A13 (1): 121–
128.
FAO. 2011. Sheep and Goat Breed of India. Corporate Document Repository.
http://www.fao.org/docrep/004/X6532E/X6532E00.HTM.
Hemm
e, 2010. IFCN Dairy Report 2010. International Farm Comparison Network. Dairy
Research Centre. Kiel. Germany.
Meyers-Raybon, D., 2010. Body scoring helps breeders evaluate condition of dairy goats.
http://www.dairygoatjournal.com/issues/82/82-3/Donna_Meyers-Raybon.html. (Accessed on
26 March 2011).
Pambu, R.G., E.C. Webb and L. Mohale, 2011. Differences in milk yield and composition of
different goat breeds raised in the same environment in South Asia. Agric. J. 6 (5): 237–242.
S
erin, I., G. Serin, M. Yilmaz, F. Kiral and A. Ceylan, 2010. The effect of body weight, body
condition score, age, lactation, serum trygliceride, cholesterol and paraoxanase levels on
pregnancy rates of Saanen goats in breeding season. J. Anim. Vet. Adv. 9: 1848–1851.
S
utama, I.K., 2011. Innovation technology in reproduction for the development of local dairy
goats. Pengembangan Inovasi Pertanian
4 (3): 231–246.
S
uharto, K., A. Junaedi, A. Kusumawati and D.T. Widayati, 2008. Comparison of fertility of
Etawa Crossbred goats in low versus ideal body condition score after estrus synchronization
and artificial insemination. Media Kedoteran Hewan
24 (1): 49–54.
Suranindiyah, Y., T.S.M. Widi, Sumadi, N.H. Tarmawati and U. Dwisepta, 2009. Production
performance of Etawa Crossbred goats in Turi Sleman Yogyakarta. The 1
st
International
Seminar on Animal Industry, 2009.
Zahraddeen, D., I.S.R. Butswat and S.T. Mbap, 2009. A note on factor influencing milk yield
of local goats under semi-intensive system in Sudan Savannah Ecological Zone of Negeria.
http://www.lrrd.org/lrrd21/3/zahr21034.htm. (Accessed on 26 March 2012).
127
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 22
Detection and Identification of Pregnancy-Associated Glycoprotein as a
Biomarker for Early Stage Pregnancy in Goats
Syaheera, N.I.
1*
, M.A.
Taib
1
, S.S. Adawiyah
2
& Z. Ismail
3
1
Universiti Sultan Zainal Abidin, Kuala Terengganu, 21300, Malaysia,
2
Institute of Biological Sciences, 50603 University of Malaya, Malaysia,
3
Department of Veterinary Services, Hulu Terengganu 21700, Malaysia.
*
Email of corresponding author: [email protected]
Introduction
In goat farming, does have to continue reproducing on regular intervals in order to increase
livestock productive efficiency. Thus, early and accurate diagnosis of pregnancy is a useful
management tool for improving efficiency of goat production so that expenses on feeding and
vaccination could be reduced (Suguna et al., 2008; Padilla-Rivas et al., 2005). The main
objective of the present study was to identify a potential early stage pregnancy biomarker,
using Pregnancy Associated Glycoprotein (PAG) in the serum of Damascus goats.
Materials and Methods
Sixteen naturally bred Damascus does were used in this study. Blood was collected through
jugular vein fortnightly from day 0 until day 42 of pregnancy. The day of mating was
considered as day 0 of pregnancy. Out of the 16 animals, 12 animals were confirmed
pregnant. Sera obtained were kept at -80
o
C until analysis. Proteomics approach was used to
seek and identify the significantly expressed proteins in the sera. To screen the serum protein
for potential biomarkers, the sera were subjected to two dimensional gel electrophoresis
(2DE) and the proteome maps obtained were analysed using the Image Master 2D Platinum
7.0. Any differentially expressed proteins were subjected to Maldi-Tof/Tof analysis for
protein identification. In order to identify PAG spot on the proteome map, immunoblotting
was performed and the spot was validated by LC-MS approach. Statistical analysis was
performed using ANOVA where P<0.05 was considered significant.
Results and Discussion
From the 2DE proteome map, four proteins were detected as differentially expressed.
Interestingly, the significantly expressed proteins with the Match ID of 196, 51, 223 and 239
were detected as early as week 2 of gestation. Compared to week 0 of pregnancy, these four
proteins seemed to be upregulated by 2-fold of expression dynamic on the week 2 of
pregnancy. However, these proteins were down regulated in week 4 of pregnancy. Pregnancy
associated glycoprotein, which was detected using immunoblotting, only appeared in week 6
of gestation and was not detected in non-pregnant samples. Based on the LC-MS results, the
protein spot was confirmed as PAG.
128
Four significantly expressed serum proteins (Match ID: 196, 51, 223 and 239) were
successfully detected in pregnant Damascus goats using 2DE approach. Since the proteins
could be detected in the second week of gestation, they have good potential to be used as a
biomarker for early stage pregnancy in Damascus goats. However, a larger sample size is
needed to determine the sensitivity and specificity of this biomarker. The PAG, which was
detected using immunoblotting in the week 6 of pregnancy, appeared as a single spot with a
molecular weight of 62 kDa and pI of 5.7. According to Sousa et al. (1998), the PAG
concentration extracted from goat placenta significantly increased from week 5 to 7 before it
began to fall again in week 9 of gestation. The molecular weight and pI of the protein spot
were similar to those of placental PAG in other species. For instance, El Amiri et al. (1994)
successfully isolated and characterised PAG from ovine placenta where the molecular weight
of the ovPAG were reported to range from 55 to 66 kDa and the pI from 4.0 to 6.8. Whilst
Sousa et al. (2002) also managed to extract PAG from zebu placenta, which possessed
molecular masses of 51 to 69 kDa and pI of 4.4 to 6.7.
Conclusions
This study successfully detected four potential biomarkers for an early stage of pregnancy in
Damascus goat. Pregnancy associated glycoprotein was also detected in goat sera where its
molecular weight and pI were comparable with those of other species.
References
El Amiri, B., B. Remy, N.M. Sousa and J.F. Beckers, 2004. Isolation and characterisation of
eight pregnancy associated glycoprotein present at high levels in the ovine placenta between
day 60 and day 100 of gestation. Reprod. Nutr. Dev. 44: 169–181.
P
adilla-Rivas, G.R., B. Sohnrey and W. Holtzΐ, 2004. Early pregnancy detection by real-time
ultrasonography in Boer goats. Small Rum. Res.
58: 87–92.
S
ousa, N.M., B. Remy, B. El Amiri, J.R.D. Figueredo, H. Banga-Mboko, P.B.D. Goncalves
and J.F. Becker, 2002. Characterisation of pregnancy associated glycoproteins extracted from
zebu placentas removed at different gestational periods. Reprod. Nutr. Dev.
42: 227–241.
S
ousa, N.M., J.M. Garbayo, J.R. Figueiredo, J. Sulon, P.B.D. Goncalves and J.F. Beckers,
1998. Pregnancy-associated glycoprotein and progesterone profiles during pregnancy and
postpartum in native goats form the north-east of Brazil. Small Rum. Res. 32: 137–147.
S
uguna, K., S. Mehrotra, S.K. Agarwal, M. Hoque, S.K. Singh, U. Shanker and T. Sarath,
2008. Early pregnancy diagnosis and embryonic and fetal development using real-time, B-
mode ultrasound in goats. Small Rum. Res.
80: 80–86.
129
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 20122
Paper 23
West African Dwarf Goat Milk Production, Composition and Kid Growth
during the Dry Season in Western Highland of Cameroon
Tendonkeng, F.
1*
, B. Boukila
2
& E.P. Tedonkeng
1
1
Department of Animal Production, FASA, University of Dschang. P.O. Box 222
Dschang, Cameroon
2
I.N.S.A.B., Université des Sciences et Techniques de Masuku, B.P. 941, Gabon
*
Email of corresponding author: [email protected]
Introduction
The production potential of the West African Dwarf goats (WADG) in Cameroon in the
Central African sub-region is very low because of lack of adequate nutrition (Pamo et al.,
2006). Grass and crop residues which form a major part of their diet especially during the
rainy season have very low nitrogen and fibre contents. Supplementation of these roughages
is a promising way of alleviating nutrient deficiencies. Different types of supplementary
feeding have been advocated to boost goat production (Leng, 2003) of which supplementing
with leguminous tree leaves has high merit. The present study was undertaken to evaluate the
effects of supplementary feeding of Calliandra calothyrsus and Leucaena leucocephala
leaves on milk production and composition of WADG.
Materials and Methods
The study was conducted with WADG in the dry season (November 2001 to April 2002).
The WADG grazed mixed pasture comprised of Brachiaria ruziziensis and Pennisetum
purpureum between 0900 and 1700 h each day. After about a month, two bucks were
introduced in the herd for a 2-month breeding period. The males were removed thereafter and
12 goats were subjected to supplementary feeding with C. calothyrsus and L. leucocephala
leaves mixed in equal quantities by weight from three months prepartum up to three months
postpartum. The mixture was left in the pens in the afternoon (1600 h) at the rate of 800 g per
goat per night. The remaining 12 goats served as unsupplemented controls. The following
observations were made: consumption of the supplements calculated from the residue every
morning, kids‟ growth, and milk production and composition, and were analysed every two
weeks from kidding up to three months. The data were analysed statistically (Steel and
Torrie, 1980) and the effects of supplementary feeding on milk production and composition
and on kids growth were evaluated.
Results and Discussion
On average the goats consumed between 700 to 800 g of the foliage supplement per head per
day during the entire study period. The peak milk production was observed in the second
week of lactation in the control group but the peak production occurred during the 3
rd
week
in the group receiving supplement (Figure 1). Supplemented goats produced more milk
(P<0.05) than controls during the entire period of the study. The average weekly milk
130
production during the period of the supplementation was almost double than that of the
control animals (361 ± 11 vs 183 ± 43 g).
The
supplementation has not significantly influenced dry matter, ash and lactose
contents of WADG milk (Table 1). Milk protein content of supplemented WADG was higher
(P<0.05) than of the control group, while lipids content in milk of the control group was
higher (P<0.05). It appeared that the supplementation with the leaves of L. leucocephala and
C. calothyrsus
had variable influence on milk composition of WADG during the dry season.
The milk consumption index of the supplemented group (5.25 ± 0.47) was
comparable with that of the control group (5.25 ± 0.38). A high significant correlation (r = +
0.9
6; P<0.01) was obtained between milk consumed and weight gain of kids of the
supplemented group.
Figure 1. Weekly milk production of WADG.
Table 2. Weight of goats at kidding and weaning
Group Weight
at kidding (kg)
Weight
at weaning (kg)
Total gain
(kg)
Daily
weight gain (g/d)
Control 1.12 ± 0.10
a
3.56 ± 0.46
a
2.44 29.0 ± 15.4
a
Supplemented 1.35 ± 0.08
b
5.95 ± 0.45
b
4.60 54.8 ± 26.3
b
a,b
Means with different superscripts within column are significantly different (P<0.05).
At kidding and weaning, the weight of kids born from supplemented goats was higher
(P<0.05) than those of control (Table 2). At weaning, the total gain of kids of the
supplemented group was almost double (4.60 kg) that of the control (2.44 kg). Also, the daily
weight gain of kids from the supplemented group was higher (P<0.05) than that of the
control.
Table 1. Average milk composition (g/100 g milk)
Group
Composition (g/100 g of milk)
DM Protein Lipids Ash
2
P Lactose
Control
14.7
± 0.8
4.1
a
± 0.3
3.8
a
± 0.4
.
0.81
± 0.04
0.09
± 0.01
6.18
± 1.18
Supplemented
14.21
± 0.98
4.35
b
± 0.34
2.56
b
± 0.27
0.80
± 0.05
0.09
± 0.003
6.48
± 0.82
ab
Means with different superscripts within column are significantly different (P<0.05). DM, dry
matter;
2
P, phosphorus
0
100
200
300
400
500
600
1 2 3 4 5 6 7 8 9 10 11 12
Milk production (g/d)
Time (weeks)
Control
Supplemented
131
Conclusions
Supplementary feeding with L. leucocephala and C. calothyrsus proved to be highly
beneficial. It substantially increased the overall yield of milk per animal, milk protein content
and growth of the supplemented animals during the dry season.
References
Leng, R.A. 2003. Draught and dry season feeding strategies for cattle, sheep and goats.
Penambul Books, Queensland, Australia.
Pamo, T.E., F. Tendonkeng, J.R. Kana, B. Boukila and A.S. Nanda, 2006. Effect of
Calliandra calothyrsus and Leucaena leucocephala supplementary feeding on goat
production in Cameroon. Small Rum. Res.
65: 31–37.
Steel, R.C. and J.H. Torrie, 1980. Principles and Procedures of Statistics. New York,
McCraw Hill Books.
132
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 24
Estimation of Genetic Parameters for Milk Production Test Day Records of
Iranian Adani (Persian Gulf) Goats
Yazdanshenas, M.S.
1*
, M. Dashtizadeh
2,3
, A. Ghotbi
1
& A. Nakisa
1
1
Bushehr Province Agricultural Jehad Organisation, Bushehr, Iran,
2
Institute of Applied
Scientific Education of Jehad-E-Agriculture, Bushehr, Iran,
3
The Centre for Research in
Agriculture and Natural Resources, Bushehr, Iran.
*
Email of corresponding author: [email protected]
Introduction
Adani dairy goat is one of the most important breeds in southern Iran. This breed is raised in
the coastal areas of Persian Gulf in Bushehr province. In these areas, the climate is harsh due
to high temperatures and humidity and the pasture is poor. Adani goats are maintained as
household animals in intensive systems. This breed has suitable milk production
characteristics and litter size and is well adapted to the harsh conditions and shortage of
forage in the coastal areas. The lactation period in Adani goats is approximately 4 months and
total milk production is between 120 to 180 kg. In dairy animals, genetic evaluation is based
on test day yields. The advantage of the test day yields for genetic evaluation over
accumulated values is that it is a more accurate estimate of environmental effects, and defines
the contemporary groups and evaluates production traits more accurately (Van der werf et al.,
1998). Several Studies have estimated the genetic parameters for milk production in goats
(Bagnicka et al., 2004; Torres-Vazquez et al., 2009; Menéndez-Buxadera et al., 2010) but
studies on genetic parameters in milk goats in Iran are scarce. There is no information on the
milk production traits of Adani goats. The aim of this study was to estimate the genetic and
phenotypic parameters for test day records of Iranian Adani goats under a multiple-trait test
day model.
Materials and Methods
The data consisting of milk test day records of Iranian Adani goats collected between 2006
and 2012 were obtained from the Adani Goats Breeding Centre of Bushehr province, Iran.
Records collected at approximately 15-day intervals of six tests were used for this analysis.
From the data, 4093 test day records of 397 goats and daughters of 20 sires were extracted.
Heritability, genetic and phenotypic correlations between test day records were estimated
using the multiple-trait test day model as follows:
where, = test day records on milk yield, = Random effect for animal, = fixed effect of year –
season of test (season defined as spring, summer, autumn and winter), = Kidding type (number of kids in
kidding), = fixed covariate of days in milk at test, = fixed covariate of age at kidding and =
residual error.
2
1
2
2
1 n
ijlk
n
ijkln
n
ijkl
n
Kjiijkl eAGEbIMDaTYSTy ijkl
y Ka i
YST j
T DIM AGE ijlk
e
133
Variance components were estimated with restricted maximum likelihood (REML)
method using the Wombat Software.
Results and Discussion
Heritability, genetic and phenotypic correlations between test day records are presented in
Table 1. Heritability estimates for test day records ranged from 0.07 to 0.58 and were highest
in the second half of lactation. Genetic correlations between test day records varied from 0.67
to 0.98. Genetic correlations between adjacent test day records were high (>0.9, averaging
0.94) and decreased as the distance between tests increased. Phenotypic correlations followed
a similar pattern but were lower than the corresponding genetic correlations.
Table1. Heritability, genetic and phenotypic
correlations between test day records of Adani goats
4
TD1 TD2 TD3 TD4 TD5 TD6
4
TD1 0.18
1
0.97
2
0.86 0.93 0.76 0.67
TD2 0.74
3
0.07 0.98 0.88 0.83 0.73
TD3 0.66 0.68 0.37 0.91 0.76 0.77
TD4 0.59 0.6 0.69 0.39 0.90 0.84
TD5 0.62 0.58 0.65 0.75 0.28 0.94
TD6 0.49 0.42 0.58 0.67 0.74 0.58
1
Heritability (diagonal),
2
genetic (above diagonal) and
3
phenotypic (below diagonal).
4
TD, test day (number
indicated day)
References
Bagnicka, E., O. Distle, H. Hamman and M. Łukaszewicz, 2004. Heritabilities and genetic
correlations between the dairy traits in goats estimated in first vs later lactations. Anim. Sci.
Pap. Rep. 22
(2): 205–213.
Menéndez-Buxadera, A., A. Molina, F. Arrebola, M.J. Gil and J.M. Serradill, 2010. Random
regression analysis of milk yield and milk composition in the first and second lactations of
Murciano-Granadina goats. J. Dairy Sci. 93: 2718–2726.
Torre
s-Vázquez, J.A., M. Valencia-Posadas, H. Castillo-Juárez and H.H. Montaldo, 2009.
Genetic and phenotypic parameters of milk yield, milk composition and age at first kidding in
Saanen goats from Mexico. Livestock Sci. 126: 147–153.
V
an der werf, J.H., M.D. Goddard and K. Meyer, 1998. The use of covariance function of
milk production based on test day record. J. Dairy Sci. 81: 3300–
3308.
Figure 1. A typical Adani doe
134
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 25
Sexual Behaviour of Indigenous Does and Ewes under Mixed Flock System
Mondal, S.K., H.C. Joshi, B.H.M. Patel
*
& T
. Dutt
Division of Livestock Production and Management, Indian Veterinary Research Institute,
Izatnagar, Uttar Pradesh 243 122 India
*
Email of corresponding author: [email protected]
Introduction
Next to poultry, sheep and goats are the main source of animal proteins to the meat-eating
population in India. Reproductive success is a must for production of viable offsprings and
their subsequent growth to increase production of meat. Due to their capability to adapt to a
wide range of climatic diversities, sheep and goats are traditionally being reared in Indian
subcontinent under the mixed flock system. There is a paucity of published information on
the goat and sheep sexual behaviour, although it plays a vital role in successful reproduction
in these ungulates, specifically under mixed flock system. Therefore, in the present study, the
sexual behavioural signs and activities were documented and compared in indigenous does
and ewes maintained under mixed flock system.
Materials and Methods
A total of 265 mating sessions were meticulously observed, both manually and
videographically, in goats (n = 3 bucks and 30 does) and sheep (n = 3 rams and 27 ewes). All
experimental animals were apparently healthy and showed general appearance and vigour
favourable for successful sexual activity. The feeding and management during the
observation period (3 months) were kept identical. The overt physical signs shown and
behavioural activities accomplished by females (Hafez, 1969) during courtship, mating and
post-mating were recorded and the data analysed for comparison between does and ewes.
Results and Discussion
Among the six prominent overt signs of female courtship, swollen vulva was the most
common in both does (93.8%) and ewes (96.9%). More does moved away from the male on
first male exposure (65.6 vs. 20.0%; P<0.01), while more ewes rubbed their necks and bodies
with males (37.5 vs. 88.4%; P<0.01) and placed their noses under males‟ flank (31.3 vs.
76.5%; P<0.01). The morning hours (05:00–09:00 h) were the most preferred time for mating
for
both does and ewes. The highest frequency of pre-mating activities was tail fanning (59.8
vs. 4.2; P<0.01) in does and turning head back (6.2) in ewes. During mating, standing still to
allow mounting was the most frequent activity for both does and ewes (2.2 vs. 3.3). Post-
mating urination was the most frequent activity in does and ewes (1.4 vs. 1.2). The longest
pre-mating activity was clustering of male for both goats and sheep (17.2 sec vs. 83.7 sec;
P<0.05). The longest pre-mating activity recorded was urination for both does and ewes
(1104.5 sec vs. 1616.0 sec). Becoming stationery to allow males to mount was found to have
135
the longest activity during mating for both does and ewes. After mating, squatting was the
longest activity for both does and ewes.
It is concluded that does and ewes showed similar sexual behaviour patterns during
pre-coital, coital and post-coital stages under mixed flock system.
References
Hafez, E.S.E., 1969. The Behaviour of Sheep and Goats. In: The Behaviour of Domestic
Animals, 2
nd
Ed., Billiere, Tindell and Cassell, London.
136
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 26
Genetic and Phenotypic Parameter Estimates for Birth Weight in Iranian
Indigenous Goats
Shamshirgaran, Y.
*
& M. Tahmoorespur
Animal Science Department, College of Agriculture, Ferdowsi University of Mashhad,
Mashhad, Iran
*
Email of corresponding author: [email protected]
Introduction
Goat production is one of the key elements contributing to the economy of farmers living in
the arid and semi-arid regions of Iran. Rapid growth during the early period can minimise the
cost of rearing and thus provide more profit to the farmer. The birth weight and early growth
rate of animals are determined not only by genetic potential but also by maternal and
environmental factors (Mandal et al., 2006). The objective of this study was to examine the
factors affecting birth weight in Iranian indigenous breed.
Materials and Methods
Data on performance and pedigree information used in this study were collected from Iranian
indigenous Cashmere goats. Initially records without date of birth or weights were
eliminated. Finally, the birth records of 814 goats, having the information of pedigree were
used for the analysis. Breeding values for birth weight were estimated for all 814 animals
using the best linear unbiased prediction (BLUP) based on an animal model with a
relationship matrix. To identify fixed effects to be included in the models, a least square
analysis was conducted using the General Linear Model (GLM) procedure (SAS Institute
Inc., 2001). This was performed with a model which included the fixed effects of year of
birth (7 classes), litter size (3 classes), sex (2 classes) and kidding parity (4 classes). All of
these fixed effects were significant (P<0.001) for birth weight, and were then included in the
model (Table 1). Estimation of variance and covariance components was obtained by
restricted maximum likelihood (REML) using a derivative-free (DF) algorithm by fitting an
animal model (Meyer, 1989). Convergence was assumed when the variance of likelihood
values was less than 10
–8
. In addition, a restart of each analysis was performed with different
starting values to attempt to avoid convergence to local maxima. The general representation
of the animal model used was as: Y = Xb + Zu + e, where Y was a n × 1 vector of records, b
denoted a vector of fixed effects in the model with an association matrix X, u
was the vector
of direct genetic effects with an association matrix Z and e denoted the vector of residual
(temporary environment) effects. The variance-covariance structure for the model was as
follows,
137
where A was the numerator relationship matrix, σu
2
was direct genetic variance and σe
2
was
variance due to residual effects.
Results and Discussion
All fixed effects studied in this study had significant effect on birth weight of kids. Litter size
had significant effect on birth weight and mean birth weight declined with larger litter size.
Due to maternal effects, dams with higher kidding parity had heavier kids. Male kids were
significantly heavier than female kids. The high variation in birth weight among the kidding
years might have been resulted from the changes in management, climate and sample size.
These findings are in agreement with the results reported in other goat breeds (Valencia et al.,
2007; Zhang et al., 2009). The estimate of direct additive heritability of 0.23 ± 0.12 for birth
weight in Iranian indigenous Cashmere goats found in the present study was lower than the
reported estimates in other goat breeds (Zhang et al., 2009). This study had a smaller sample
size and fitted a model which did not consider the maternal genetic effect and permanent
maternal environmental effect.
As a conclusion, the fixed factors such as kidding parity and litter size of dam, kidding year
and sex of kids are important for birth weight trait in Iranian indigenous Cashmere goat
breed, and should be fitted in the models.
Table 1. Birth weight for litter size, kidding parity, sex and year of birth of kids of the Iranian
indigenous Cashmere goats
Fixed effect N LSM ± SE Fixed effect N LSM ± SE
Litter size Sex
1 507 2.30 ± 0.027
a
Female 407 1.85 ± 0.033
a
2 261 1.96 ± 0.031
b
Male 407 2.04 ± 0.031
b
3 46 1.57 ± 0.062
c
Year of birth
Kidding parity 2000 119 1.77 ± 0.050
e
1 375 1.82 ± 0.029
a
2001 177 2.11 ± 0.042
a
2 268 1.92 ± 0.030
bcd
2002 228 1.91 ± 0.034
cde
3 145 1.99 ± 0.040
bcd
2004 33 1.89 ± 0.072
cde
4 26 2.04 ± 0.079
bcd
2005 91 2.05 ± 0.049
abc
2006 119 1.99 ± 0.040
bcd
2007 47 1.88 ± 0.058
cde
abcde
Means with different superscripts within each fixed effect were significantly different at P<0.05. N, number
of records; LSM, least-square means; SE, and standard errors
2
2
0
0
e
u
Ie
A
e
u
V
138
References
Mandal, A., F.W.C. Neser, P.K. Rout, R. Roy and D.R. Notter, 2006. Estimation of direct and
materna
l (co) variance components for pre-weaning growth traits in Muzaffarnagari sheep.
Livestock Sci.
99: 79–89.
Meyer, K. 1989. Restricted maximum-likelihood to estimate variance-components for animal
models with several random effects using a derivative-free algorithm. Genet. Sel. Evol. 21:
317
–40.
Valencia, M., J. Dobler and H.H. Montaldo, 2007. Genetic and phenotypic parameters for
lactation traits in a flock of Saanen goats in Mexico. Small Rum. Res.
68: 318–322.
Z
hang, C.Y., Y. Zhang, D.Q. Xu, X. Li, J. Su and L.G. Yang, 2009. Genetic and phenotypic
parameter estimates for growth traits in Boer goat. Livestock Sci.
124: 66–71.
139
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Lead Paper 3
Taur
ine-Rich Goat Milk
Gupta, R.C.
SASRD Nagaland University, Medziphema 797106 India
Email of corresponding author: [email protected]
Introduction
Traditionally goat milk served as part of daily diet for the rural family but has fast becoming
a health food for the sick and wealthy in the cities. Goat milk is reported to contain
significant quantity of various immune-protective proteins, essential minerals, omega acids
and large quantities of vitamins (Tommaso et al, 2004; Belewu and Adewole, 2009). In
addition, the presence of free amino acids in goat milk, not required for protein synthesis of
the host animal is also important for human health. Many of the free amino acids are integral
part of several life processes and one of such free amino acids is Taurine. Taurine is a sulfur-
containing amino acid and is chemically known as 2-aminoethanesulfonic acid. The
concentration of taurine in goat milk is 20-fold higher than in cow milk and almost equal to
that in human milk. Although colostrum from cows contains high concentration of taurine, it
is still lower than that in goat milk. As a result, commercial milk formula is often enriched
with taurine to increase its content. On the other hand, newborns and infants fed on goat milk
do not need additional taurine since its content in the goat milk is almost similar to that in
mothers‟ milk (Park et al., 2007).
Taurine is well-recognised to be beneficial to almost all life processes in the body, it
is increasingly becoming an important component of food and nutraceuticals (Gupta and
Kim, 2003; Gupta et al., 2005; Gupta et al., 2009).
Taurine content in Goat Milk Products
Goat milk at all stages of lactation has a high content of taurine. Among the dairy
products from goat milk, whey has the highest taurine content, while cheese contains 12.5 to
16.5%. Taurine in milk products is not affected by high temperature treatment as cheese from
the Cacioricotta goat milk produced by heating milk to 95 °C remained higher in taurine. In
addition, taurine content in milk products does not vary with fermentation and storage period
(Pasqualone et al., 2003).
Taurine Biological Action and as Components of Functional and Nutraceuticals
There is increasing evidence that sulfur amino acids (SAAs) play an important
metabolic and functional role in human health and disease prevention. The SAAs also
provide elemental sulfur required for growth and development, and are good sources of
energy and nutrient need for various life processes.
It is possible and feasible to modulate body functions for better health by
consumption of food rich in taurine. Taurine can contribute to many aspects of health, for
example it has liver protection, cardio protection, retino protection and bone loss prevention
140
activities. In addition it could act as anti-cancer, anti-bacteria, anti-diabetes, anti-aging, anti-
inflammatory, anti-hypertension, anti-oxidant, anti-craving agents. It also contributes to bile
salt formation. The mode of action by taurine in the prevention of diseases is suggested to be
as follows:
Figure 2: Role of taurine in disease prevention.
Conclusions
Goat milk riched in taurine or taurine- supplemented food and formula can provide long term
beneficial effects to general health of humans.
References
Belewu, M.A. and A.M. Adewole, 2009. Goat Milk: A Feasible Dietary Based Approach to
Improve the Nutrition of Orphan and Vulnerable Children. Pakistan J. Nutr. 8
(10): 1711–
1714.
Gupta R. C. and S.J. Kim, 2003. Role of Taurine in organs‟ dysfunction and in their
alleviation. Crit. Care Shock
6: 171–177.
Gupta, R.C., M. D‟Archivio and R. Masella, 2009. Taurine as drug and functional food
component; Glutathione and sulfur Amino Acids in human health and disease. John Wiley
and Sons, Inc., Philadelphian, USA, pp. 543–578.
Gupta
, R.C., T.Win and S. Bittner, 2005. Taurine analogues, a new class of Therapeutic:
Retrospect and prospects. Curr. Med. Chem
. 12: 2021–2039.
Taurine
Myeloperoxidase
Hypochlorous
acid production
Taurine
chloramine
Tissue
damage
Inflammatory
mediator release
Nitric oxide generation
by iNOS
Primary Insult (free radicals, toxic chemicals, microbes)
Secondary Insult (neutrophils activation and accumulation)
141
Park, Y.W., M. Ju´arez, M. Ramosc and G.F.W. Haenlein, 2007 Physico-chemical
cha
racteristics of goat and sheep milk. Small Ruminant Re
s. 68: 88–113.
Pasqualone, A., F. Caponio and
M.T. Bilanciam, 2003 Distribution of taurine during cheese
-
making from goat milk. Milchwissenschaft 58: 619–
621.
Tommaso, R.I., I.D. Catal, T. Giovanni and B. Giuliana, 2004. Improved determination of
taurine by high-performance anion-exchange chromatography with integrated pulsed
amperometric detection (HPAEC-IPAD) Anal. Bioanal. Chem.378
(3): 804–810.
142
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9 –12 April 2012
Paper 27
“Feed less Food” – Effect of a Low Concentrate Diet on Milk Quality, Milk
Fatty Acid Composition and Performance of Dairy Goats
Georg, H.
*
, K. Sporkmann, S. Bender, G. Ude & G. Rahmann
Thunen-Institute of Organic Farming, Trenthorst 32, D-23847 Westerau, Germany
*
Email of corresponding author: [email protected]
Introduction
More than a third of the world's grain harvest is used to feed animals. According to the
environmental agency of the United Nations, losses of calories by poor conversion efficiency
of grain into animal food could theoretically feed 3.5 billion people (McIntyre, 2009). This
shows that the production of animal protein is very energy consuming, especially when
concentrates are fed to ruminants. Consequently, a major goal is to explore the potential of
dairy goats for producing high quality milk in an extensive system but in an ecological
friendly way.
Ruminants can be divided into three categories based on their feeding behaviour:
concentrate selectors (CS), grass and roughage grazers (GR) and intermediate feeders (IM)
(Hofmann, 1989). CS feeders include deer and elk, whereas cattle and sheep are all grazers.
Goats together with chamois, red deer, fallow deer belong to the IM feeders. IM feeders are
able to browse bushes and even trees besides consuming traditional ruminant diets. Goats are
generally very selective in choosing feed of the highest quality, thereby optimising the quality
of their roughage diet. Due to their anatomical advantages and excellent roughage conversion
efficiency, goats are destined to produce high quality milk at a minimum amount of
concentrates in their ration. Thus, the objective for this study was to measure the effects of a
low concentrate diet on fatty acid composition and milk yield of dairy goats.
Materials and Methods
In 2011, 50 dairy goats of our experimental herd were divided into two homogenous groups
of 25 goats each based on parity, milk yield and body weight. One group (KF10) was fed
according to the Bio Suisse guidelines with 10% concentrate and the other group (KF40) in
accordance with the requirements of the EC regulation on organic farming with a 40%
concentrate in the ration. The concentrate consisted of 100% wheat grist. Mineral licks were
made available to the animals. Limited grazing was offered to both groups during the
growing season. During the entire lactation period, the herds were extensively monitored,
which include recording of monthly milk production and bodyweight change, biweekly feed
sampling (concentrate, hay and fresh grass). In addition, milk samples were taken weekly to
assess milk composition. Data were statistically analysed using SAS 9.3 (SAS Institute Inc.).
Test of normality was done by calculating Shapiro-Wilk-test (proc univariate). Where
appropriate, Student‟s t-test or non-parametric test procedures were used to compare group
means, box-whisker plots were created to illustrate data distributions.
143
Results and Discussion
Figure 1 shows the annual milk yield, fat and protein contents. The fatty acid compositions
are of monthly samples. Milk yield of KF10 was 68.8 kg, and fat and protein contents were
4.1 and 2.4 kg, respectively lower compared to those of KF40. The annual amount of
concentrates for KF10 was 66 kg/goat, whereas it was 259 kg/goat for KF40.
Figure 1. Annual milk yield, fat and protein contents of goats fed according to Bio
Suisse guidelines (KF10) and EC regulation on organic farming
(KF40)
Conjugated linolenic acid (CLA, C18: 2 c9t11), as an example of fatty acids analysed
in this study, was higher in KF10 throughout the whole lactation period (Figure 2). Body weight was significantly lower for KF10 during the last three months of lactation. Health status, checked regularly for both groups, did not show any difference. The results indicate that less concentrate feeding is feasible. Future studies should quantify selective abilities of goats as a base of breeding selection.
400
500
600
700
800
0
10
20
30
Milk Fat Protein
Annual performance 2011
400
500
600
700
800
Milk Yield [kg]
0
10
20
30
Fatand Protein [kg]
KF40KF10Treatment
1
44
Figure 2. Conjugated linolenic acid content in milk of goats fed according to Bio Suisse
guidelines (KF10) and EC regulation on organic farming (KF40)
References
Hofmann, R.R., 1989. Evolutionary steps of ecophysiological adaptation and diversification
of ruminants: a comparative view of their digestive system, Oecologia
78 (4): 443–457.
Mc
Intyre, B.D., 2009. International Assessment of Agricultural knowledge, Science and
Technology for Development: Agriculture at a crossroads. Global report. Washington, DC:
Island Press.
Year2011
0.0
0.2
0.4
0.6
0.8
1.0
1.2
0.0
0.2
0.4
0.6
0.8
1.0
0.0
0.2
0.4
0.6
0.8
1.0
1.2
CLA [g/100 g FA]
April May June July August September October
KF40KF10Treatment
145
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 28
Comparative Studies of Milk Components of West African Dwarf Goats
and Sheep
Agbede, J.O. & N.A. Fajemisin
*
Department of Animal Production and Health, Federal University of Technology
Akure, Nigeria
*
Email of corresponding author: [email protected]
Introduction
Dairy and dairy products are important food components especially for infants, school
children and other protein vulnerable population. Unfortunately these products are in short
supply in under-developed countries. In Nigeria less than 20% of protein intake is of animal
origin compared to about 70% in the United States (Onu and Okongwu, 2006). In Nigeria,
cow is the traditional dairy animal while goats and sheep are kept for meat, hide and skin.
There are 12.2 million cattle, 13.2 million sheep and 26.0 million goats in Nigeria (Olukunle
and Agbede, 2010). Despite all these, Nigeria continues to depend on imported dairy products
which continue to deplete her limited foreign reserves. A viable solution is to exploit local
resources to enhance dairy production. Information on milk composition in Nigeria deals
largely with cattle (Adeneye, 1989) with limited information on goat milk (Akinsoyinu et al.,
1977). The objective of this study was to compare the milk composition of West African
Dwarf goats and sheep with a view to popularising goat milk consumption among the low
income earners in peri-urban cities of Nigeria.
Materials and Methods
Four lactating West African Dwarf (WAD) does and four ewes between 1½ to 2½ years old
of unknown parity were used for the study. The animals were allocated to the trial at 3 weeks
after parturition and were raised on a semi-intensive system provided with cassava peels
supplemented with Morus alba. Hand milking was done at 06.00 h thrice per week on the
designated milking days to collect milk samples for 10 weeks. The milk samples collected
were immediately stored at -5
o
C prior to analysis. Milk samples were analysed for total
solids, fat, crude protein, lactose and total ash while the solid-not-fat (SNF) were calculated
as the difference between the total solids and fat composition of the milk. The concentrations
of Ca, Mg, P, Na and K were determined and all data collected were subjected to Student‟s t-
test.
Results and Discussion
Milk composition of the WAD goats and sheep are presented in Table 1. There were no
significant (P>0.05) differences for any of the parameters measured between goats and sheep
except for K concentration. However, total solid, solid-not-fat, fat and lactose contents in
goat milk were numerically higher than those in sheep milk, thus suggesting that goat milk
could be of better source of dietary energy but not for protein than sheep milk. The present
146
data were comparable to those reported for other breeds of goats and sheep (Akinsoyinu et
al., 1977). The results also indicated that among all the minerals analysed, only K
concentration was significantly (P<0.05) influenced by species effect. Generally, the values
of the macrominerals recorded in this study compared favourably with those reported for goat
milk by Akinsoyinu and Akinyele (1979).
Table 1. Milk composition of WAD goat and their interrelationships
Parameters WAD goat WAD sheep
Total Solid (g/kg) 156.1 ± 2.05 147.2 ± 1.41
Solid Not Fat (g/kg) 114.2 ± 2.12 112.3 ± 1.21
Protein (g/kg) 42.7 ± 1.01 48.8 ± 0.41
Fat (g/kg) 40.2 ± 1.02 36.9 ± 1.38
Lactose (g/kg) 56.6 ± 1.30 55.5 ± 1.18
Ash (g/kg) 7.9 ± 0.97 8.3 ± 0.14
Fat/SNF ratio 0.35 ± 0.13 0.33 ± 0.15
Protein/Fat ratio 1.06 ± 0.31 1.32 ± 0.21
Calcium (mg/100 mL) 128.41 ± 12.40 128.51 ± 12.01
Magnesium (mg/100 mL 22.11 ± 10.31 24.7 ± 7.37
Phosphorus (mg/100 mL) 69.97 ± 5.11 69.81 ± 7.12
Sodium (mg/100 mL) 71.31 ± 8.12 61.66 ± 3.13
Potassium (mg/100 mL) 126.13
a
± 10.31 115.66
b
± 10.81
ab
Means in the same row with different superscripts differ significantly (P<0.05)
References
Akinsoyinu, A.O., A.U. Mba and R.O. Olubajo, 1977. Studies of milk yield and composition
of West African Dwarf goats in Nigeria. J. Dairy Res. 46: 57–
62.
Akinsoyinu, A.O. and I.O. Akinyele, 1979. Major elements in the milk of West African
Dwarf goats as affected by stage of lactation. J. Dairy Res. 46: 427–
431.
Onu, P.N. and S.N. Okongwu, 2006. Performance characteristics and nutrient utilisation of
starter broilers fed raw and processed pigeon pea (Cajanus cajan) seed meal. Int. J. Poult.
Sci.
5 (7): 693–697.
Olukunle, O.J
. and J.O. Agbede, 2010. Integrated Approach to Food Security in Nigeria.
JoST 1 (1): 92–106.
Adeneye, J.A., 1989. Variation in yield composition of milk from different quarters of
lactating white Fulani cattle in tropical environment. Nig. J. Animal Prod. 16: 8–15.
147
Proceedings of the 1
st
Asia Dairy Goat Conference, Kuala Lumpur, Malaysia, 9–12 April 2012
Paper 29
Introduction of Goat Milk Pasteurisation Equipment to the Etawah
Crossbred Dairy Goat Farmers in East Java Province,
Indonesia
Anam, C., J. Riyanto
*
& A.A. Rofiq
Sebelas Maret University, 57126 Surakarta, Indonesia
*
Email of corresponding author: [email protected]
Introduction
An important characteristic of goat milk is the unique „goaty‟ flavour which is attributed to
the different fatty acids and the relatively higher proportions of short and medium chain fatty
acids in goat milk (Tziboula-Clarke, 2003). Jandall (1996) reported that the composition of
goat milk as: 3.80% fat, 8.68% solid-non-fat, 4.08% lactose, 2.90% protein, 2.41% casein,
0.43%
whey proteins, 0.79% total ash, 0.194% Ca, and 0.270% P, while recently Pall et al.
(2011) showed that goat milk contained 4–
4.5% fat, 3.2% lactose, 4.6% protein, 0.129% Ca,
and 0.106% P.
In
East Java, goat milk has not been fully utilised because of the lack of milk processing
equipm
ent at farm level; hence almost all the milk produced is for the consumption of the
kids. It is often that the kids are unable to consume all the milk, resulting in incomplete milk
let down and retention in the udder. Also goat milk has short shelf life and therefore
availability of proper processing and storage equipment at the farm level is needed to
preserve its quality to market it for human consumptions (Susilorini and Sawitri, 2002). The
objective of this study was to determine the effect of introducing milk pasteurisation, simple
cup
-sealer equipments and training of the goat farmers on the production of pasteurised goat
milk. Capacity building of farmers in Ngambe Ngawi district to produce dairy products from
goat milk was also conducted.
Materials and Methods
Training on milk pasteurisation was held for the Etawah crossbred dairy goat farmers in the
Ngambe Ngawi district, East Java Province, Indonesia. Twenty-five farmers, having a total of
70 heads of Etawah crossbred goats with an average milk production of 1.05 (0.75 to 1.25)
litre/head/day, were selected for the study. Milk pasteurisation equipment, cup-sealer and
traini
ng in handling the equipment and in dairy goat management were provided to the above
farmers.
The milk pasteurisation equipment had a capacity of 30 litres per batch and this
equipment was easy to operate because it is regulated using several simple keys. It is also
easy to maintain. The main function of this equipment was to pasteurise goat milk to produce
a "commercially sterile" product (Winarno, 1994). Goat milk was pasteurised at a
temperature of 65–70
o
C for 30–40 minutes. Participants were trained to operate and maintain
the mi
lk pasteurisation equipment. Functions of each component and on how to use them
were explained. To increase the income of farmer, the participants were also trained to make
different dairy products such as beverages, candy, “dodol” and caramel.
148
Results and Discussion
All participants were able to use the milk pasteurisation equipment and the cup sealer but
only 25% of the participants could make dairy products. In order to increase milk production
and
farmers‟ income and to enhance the flavour of milk as demand by the community, it was
suggested that goat milk must be pasteurized and dairy products such as “dodol”, ice cream
and candy milk should be introduced (Winarno and Fernandez, 2007). The study showed that
after the training, the participants were capable to use the milk pasteurisation equipment
properly and made dairy products from goat milk.
Co
nclusions
Introduction of milk pasteurisation equipment and training on making goat milk products had
shown to be beneficial to the farmers. After taking the training, the farmers were able to
create new businesses. In addition to pasteurised milk, farmers could produce fruit syrup,
“dodol”, ice cream and candy from goat milk.
References
Jandal, J.M., 1996. Comparative aspects of goat and sheep milk. Small Ruminant Res. 22:
177
–185.
Pall, U.K., P.K. Mandal., V.K. Rao and C.D. Das, 2011. Quality and Utility of Goat Milk
with Special Reference to India: An Overview. Asian J. Anim. Sci. 6 (1): 56–63. ISSN 1819–
1878.
Susilorini, T.E. and M.E. Sawitri, 2002. Processed Milk Products, Publishing of Swadaya,
Jakarta.
Tziboula-Clarke, A., 2003. Encyclopedia of Dairy Science. Vol. 2, Academics Press,
California, USA.
Winarno, F.G., 1994, Commercialsterilisation of food products, Gramedia Pustaka Utama,
Jakarta.
Winarno, F.G. and I.E. Fernandez, 2007. Milk and fermentation products, M-Brio Press,
Bogor.